Search for Variation information by Variation ID:
Detailed information for vg0127793179:
| Variant ID: vg0127793179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27793179 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 304. )
Flanking Sequence (100 bp) in Reference Genome:
TACTCCGCTTGATTATTAGTCGCGTAAGGCTTAATAGTATAAGCAAACTCGAAACATGCCCCCCTAGGGGAAATTATAACTAGGCCGATACCACAACCAT[G/A]
AGTACATACCGATCCATCAAAGAATAAAGTCCATGGCACCATTTCAACCGAGCCGATTGAATCATCACGATGTTCCACAATAAAATCGGCTATAGCTTGT
Reverse complement sequence
ACAAGCTATAGCCGATTTTATTGTGGAACATCGTGATGATTCAATCGGCTCGGTTGAAATGGTGCCATGGACTTTATTCTTTGATGGATCGGTATGTACT[C/T]
ATGGTTGTGGTATCGGCCTAGTTATAATTTCCCCTAGGGGGGCATGTTTCGAGTTTGCTTATACTATTAAGCCTTACGCGACTAATAATCAAGCGGAGTA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 10.20% | 1.42% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 3.70% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.90% | 78.80% | 15.24% | 0.00% | NA |
| Indica I | 595 | 88.10% | 9.60% | 2.35% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 3.70% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127793179 | G -> A | LOC_Os01g48490.1 | missense_variant ; p.His1277Tyr; MODERATE | nonsynonymous_codon ; H1277Y | Average:24.652; most accessible tissue: Minghui63 flag leaf, score: 39.69 | possibly damaging  |
1.983 |
DELETERIOUS | 0.05 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127793179 | NA | 2.32E-11 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127793179 | NA | 2.23E-16 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127793179 | NA | 5.10E-08 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127793179 | NA | 8.65E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127793179 | NA | 2.03E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127793179 | 1.93E-06 | NA | mr1987_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |