\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127776647:

Variant ID: vg0127776647 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27776647
Reference Allele: GAlternative Allele: C,A,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTATAGACTATCTCCATGTTAGTAGATAGCTTTGCTCTCTCTCTTCATTTAATCTCTTCCAAGTAGGAAAATATGCTGACATGGATCTCTTGTAGAGA[G/C,A,T]
CTTATAGATAACTATTGTGGGTGCCCTAAGCTGTGCGCGCGGGGGGAAGAGAGAGCGACGTCTCCGCGGCGCTGTCGGGGGGAGGACGGCCACTCGTGTC

Reverse complement sequence

GACACGAGTGGCCGTCCTCCCCCCGACAGCGCCGCGGAGACGTCGCTCTCTCTTCCCCCCGCGCGCACAGCTTAGGGCACCCACAATAGTTATCTATAAG[C/G,T,A]
TCTCTACAAGAGATCCATGTCAGCATATTTTCCTACTTGGAAGAGATTAAATGAAGAGAGAGAGCAAAGCTATCTACTAACATGGAGATAGTCTATAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.30% 12.80% 5.69% 62.10% A: 0.06%; T: 0.02%
All Indica  2759 4.90% 1.10% 4.17% 89.78% A: 0.11%
All Japonica  1512 49.20% 36.00% 8.66% 6.02% T: 0.07%
Aus  269 5.60% 0.00% 2.97% 91.45% NA
Indica I  595 9.20% 0.00% 6.72% 84.03% NA
Indica II  465 5.60% 2.40% 1.08% 90.97% NA
Indica III  913 1.00% 0.90% 4.16% 93.65% A: 0.33%
Indica Intermediate  786 5.60% 1.40% 4.07% 88.93% NA
Temperate Japonica  767 79.50% 16.00% 3.78% 0.65% NA
Tropical Japonica  504 7.90% 63.30% 14.88% 13.69% T: 0.20%
Japonica Intermediate  241 39.00% 42.70% 11.20% 7.05% NA
VI/Aromatic  96 7.30% 0.00% 8.33% 84.38% NA
Intermediate  90 12.20% 35.60% 7.78% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127776647 G -> T LOC_Os01g48444.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> T LOC_Os01g48446.1 downstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> T LOC_Os01g48440-LOC_Os01g48444 intergenic_region ; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> A LOC_Os01g48444.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> A LOC_Os01g48446.1 downstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> A LOC_Os01g48440-LOC_Os01g48444 intergenic_region ; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> DEL N N silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> C LOC_Os01g48444.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> C LOC_Os01g48446.1 downstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N
vg0127776647 G -> C LOC_Os01g48440-LOC_Os01g48444 intergenic_region ; MODIFIER silent_mutation Average:95.308; most accessible tissue: Zhenshan97 flag leaf, score: 99.449 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0127776647 G A -0.06 -0.1 -0.06 -0.09 -0.06 -0.05
vg0127776647 G C -0.02 -0.03 -0.06 -0.02 -0.02 -0.02
vg0127776647 G T -0.05 -0.1 -0.07 -0.08 -0.06 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127776647 NA 3.58E-12 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.97E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 4.78E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 3.95E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 1.79E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 3.81E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.63E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.99E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 6.60E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 4.82E-10 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 3.54E-08 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.33E-10 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 4.98E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.03E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 4.31E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 9.28E-11 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.59E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 4.74E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.01E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.56E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 5.21E-06 3.17E-09 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 1.02E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 7.51E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.52E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.47E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 1.73E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 4.84E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.01E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.71E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 8.38E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 1.08E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 9.73E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 1.08E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 5.04E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 9.33E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 2.12E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 9.00E-21 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127776647 NA 1.73E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251