\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127650549:

Variant ID: vg0127650549 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27650549
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TACCTAATAAGAAAATACGTAAGGTTTCCGGAAATTTTTTTTCGTCCGTCTCTTTTTTTTCTCTTTTTTCGCTATTTTCACCGTATTTTCCTTTTTTTTC[C/T]
GTCTTCCGCTTTTTTCTTTCCGCCGCCTTTTTTTTCTCCTTTTCCGTTATTTTTTTTCGTCTCTTTTTTATCCCCTTTTTTCCGTTCCTTTTTTTTTTGC

Reverse complement sequence

GCAAAAAAAAAAGGAACGGAAAAAAGGGGATAAAAAAGAGACGAAAAAAAATAACGGAAAAGGAGAAAAAAAAGGCGGCGGAAAGAAAAAAGCGGAAGAC[G/A]
GAAAAAAAAGGAAAATACGGTGAAAATAGCGAAAAAAGAGAAAAAAAAGAGACGGACGAAAAAAAATTTCCGGAAACCTTACGTATTTTCTTATTAGGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 34.30% 6.58% 8.02% NA
All Indica  2759 85.60% 1.70% 5.62% 7.07% NA
All Japonica  1512 0.90% 98.20% 0.40% 0.46% NA
Aus  269 3.70% 12.30% 38.66% 45.35% NA
Indica I  595 85.40% 0.50% 4.20% 9.92% NA
Indica II  465 94.80% 3.70% 0.65% 0.86% NA
Indica III  913 79.40% 1.20% 9.20% 10.19% NA
Indica Intermediate  786 87.40% 2.20% 5.47% 4.96% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 98.20% 0.60% 0.79% NA
Japonica Intermediate  241 1.20% 96.30% 1.24% 1.24% NA
VI/Aromatic  96 5.20% 7.30% 41.67% 45.83% NA
Intermediate  90 27.80% 53.30% 6.67% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127650549 C -> T LOC_Os01g48230.1 downstream_gene_variant ; 905.0bp to feature; MODIFIER silent_mutation Average:35.618; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0127650549 C -> T LOC_Os01g48220-LOC_Os01g48230 intergenic_region ; MODIFIER silent_mutation Average:35.618; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0127650549 C -> DEL N N silent_mutation Average:35.618; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127650549 NA 8.91E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 3.87E-23 mr1021 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 2.48E-76 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 4.44E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 8.04E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 1.11E-23 mr1477 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 3.49E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 1.19E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 2.69E-76 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 7.31E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 6.14E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 7.00E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 9.34E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 2.77E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 7.72E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 2.52E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 1.61E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 2.24E-32 mr1477_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 7.32E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 2.14E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 4.12E-59 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 1.75E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 1.28E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 5.94E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127650549 NA 6.70E-51 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251