Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127580582:

Variant ID: vg0127580582 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27580582
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTATTGATTTTGGCATAAGTTAGCATCAATCTAAATGGCTAGTACTCCCTCCGTCCCAAAATAAGTGTAGTTTTACACTGTTCATGTCCAATGTTTGA[C/T]
CGTTCGTCTTATTAAAAAAAATGATTAGTATTTATATTGTTATTAGATTATAAATATGAATAGTACTTTATGTGTGACTATTTTTTAAAAAAAGTAATAA

Reverse complement sequence

TTATTACTTTTTTTAAAAAATAGTCACACATAAAGTACTATTCATATTTATAATCTAATAACAATATAAATACTAATCATTTTTTTTAATAAGACGAACG[G/A]
TCAAACATTGGACATGAACAGTGTAAAACTACACTTATTTTGGGACGGAGGGAGTACTAGCCATTTAGATTGATGCTAACTTATGCCAAAATCAATAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	8.10%	0.42%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.04%	0.00%	NA
All Japonica	1512	76.40%	22.50%	1.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.10%	0.30%	0.65%	0.00%	NA
Tropical Japonica	504	37.90%	60.50%	1.59%	0.00%	NA
Japonica Intermediate	241	84.60%	13.70%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	22.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127580582	C -> T	LOC_Os01g48170.1	upstream_gene_variant ; 1566.0bp to feature; MODIFIER	silent_mutation	Average:61.158; most accessible tissue: Minghui63 flower, score: 78.426	N	N	N	N
vg0127580582	C -> T	LOC_Os01g48160.1	downstream_gene_variant ; 2134.0bp to feature; MODIFIER	silent_mutation	Average:61.158; most accessible tissue: Minghui63 flower, score: 78.426	N	N	N	N
vg0127580582	C -> T	LOC_Os01g48160-LOC_Os01g48170	intergenic_region ; MODIFIER	silent_mutation	Average:61.158; most accessible tissue: Minghui63 flower, score: 78.426	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127580582	6.57E-07	NA	mr1057	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	4.97E-10	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	3.10E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	1.23E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	5.47E-13	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	2.32E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	2.76E-30	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	4.26E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	2.24E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	3.00E-15	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	2.76E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	1.15E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	4.95E-10	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	9.78E-11	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	7.52E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	1.86E-14	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	5.28E-16	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	3.89E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	5.02E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	8.15E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	1.64E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	2.29E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	1.39E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	4.27E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127580582	NA	2.87E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251