\
| Variant ID: vg0127430545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27430545 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 80. )
AGCAGTTGAGTGACCATATTAAGTGCTCAAATGTGAATTTCCCCAAAATTTAATATTGTCCAATATTTAATATATATCCTAGATTTTTATAATTTCCTAT[G/A]
TTTGGGATTTTGGTATTTATATGTTTTCACATATATTGGTTTATCTTTTTGGATTGGTTTTACCACCACATGGATTTCTATAATTTAGCATTTGTGATTC
GAATCACAAATGCTAAATTATAGAAATCCATGTGGTGGTAAAACCAATCCAAAAAGATAAACCAATATATGTGAAAACATATAAATACCAAAATCCCAAA[C/T]
ATAGGAAATTATAAAAATCTAGGATATATATTAAATATTGGACAATATTAAATTTTGGGGAAATTCACATTTGAGCACTTAATATGGTCACTCAACTGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 38.40% | 5.69% | 0.85% | NA |
| All Indica | 2759 | 86.00% | 3.90% | 8.77% | 1.34% | NA |
| All Japonica | 1512 | 1.70% | 97.40% | 0.93% | 0.00% | NA |
| Aus | 269 | 27.90% | 68.80% | 2.60% | 0.74% | NA |
| Indica I | 595 | 80.20% | 4.20% | 14.62% | 1.01% | NA |
| Indica II | 465 | 77.80% | 5.40% | 14.41% | 2.37% | NA |
| Indica III | 913 | 95.20% | 1.40% | 1.64% | 1.75% | NA |
| Indica Intermediate | 786 | 84.60% | 5.60% | 9.29% | 0.51% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 3.20% | 94.20% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 55.60% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127430545 | G -> A | LOC_Os01g47920.1 | upstream_gene_variant ; 3806.0bp to feature; MODIFIER | silent_mutation | Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0127430545 | G -> A | LOC_Os01g47930.1 | upstream_gene_variant ; 1527.0bp to feature; MODIFIER | silent_mutation | Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0127430545 | G -> A | LOC_Os01g47920-LOC_Os01g47930 | intergenic_region ; MODIFIER | silent_mutation | Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| vg0127430545 | G -> DEL | N | N | silent_mutation | Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127430545 | NA | 1.32E-24 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | NA | 2.63E-14 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | 5.63E-06 | 3.10E-25 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | NA | 3.83E-25 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | NA | 1.44E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | NA | 1.53E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | NA | 9.26E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | 1.13E-06 | 4.10E-27 | mr1051_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127430545 | NA | 6.98E-26 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |