\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127430545:

Variant ID: vg0127430545 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27430545
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAGTTGAGTGACCATATTAAGTGCTCAAATGTGAATTTCCCCAAAATTTAATATTGTCCAATATTTAATATATATCCTAGATTTTTATAATTTCCTAT[G/A]
TTTGGGATTTTGGTATTTATATGTTTTCACATATATTGGTTTATCTTTTTGGATTGGTTTTACCACCACATGGATTTCTATAATTTAGCATTTGTGATTC

Reverse complement sequence

GAATCACAAATGCTAAATTATAGAAATCCATGTGGTGGTAAAACCAATCCAAAAAGATAAACCAATATATGTGAAAACATATAAATACCAAAATCCCAAA[C/T]
ATAGGAAATTATAAAAATCTAGGATATATATTAAATATTGGACAATATTAAATTTTGGGGAAATTCACATTTGAGCACTTAATATGGTCACTCAACTGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 38.40% 5.69% 0.85% NA
All Indica  2759 86.00% 3.90% 8.77% 1.34% NA
All Japonica  1512 1.70% 97.40% 0.93% 0.00% NA
Aus  269 27.90% 68.80% 2.60% 0.74% NA
Indica I  595 80.20% 4.20% 14.62% 1.01% NA
Indica II  465 77.80% 5.40% 14.41% 2.37% NA
Indica III  913 95.20% 1.40% 1.64% 1.75% NA
Indica Intermediate  786 84.60% 5.60% 9.29% 0.51% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 3.20% 94.20% 2.58% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 37.80% 55.60% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127430545 G -> A LOC_Os01g47920.1 upstream_gene_variant ; 3806.0bp to feature; MODIFIER silent_mutation Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0127430545 G -> A LOC_Os01g47930.1 upstream_gene_variant ; 1527.0bp to feature; MODIFIER silent_mutation Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0127430545 G -> A LOC_Os01g47920-LOC_Os01g47930 intergenic_region ; MODIFIER silent_mutation Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg0127430545 G -> DEL N N silent_mutation Average:25.856; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127430545 NA 1.32E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 NA 2.63E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 5.63E-06 3.10E-25 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 NA 3.83E-25 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 NA 1.44E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 NA 1.53E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 NA 9.26E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 1.13E-06 4.10E-27 mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127430545 NA 6.98E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251