Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127415010:

Variant ID: vg0127415010 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27415010
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGGAATATTAGAAGTAGAGTATAGAGTTCATATAGAAATACAATTAGAAAATAACTGAAATTCGGAATTAAAAATAAGAAATATTAGAAGTAGAGTA[T/C,A]
AGAGTCCATATATAAAAACAATTAAGAAAAAAAATAGAAATTCGGAATTAAAAAGTAAGGAATATTATAAGTAGAGTGTAGAGTCTATATAGAAATTTAA

Reverse complement sequence

TTAAATTTCTATATAGACTCTACACTCTACTTATAATATTCCTTACTTTTTAATTCCGAATTTCTATTTTTTTTCTTAATTGTTTTTATATATGGACTCT[A/G,T]
TACTCTACTTCTAATATTTCTTATTTTTAATTCCGAATTTCAGTTATTTTCTAATTGTATTTCTATATGAACTCTATACTCTACTTCTAATATTCCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	39.70%	1.18%	0.32%	A: 0.04%
All Indica	2759	93.20%	4.30%	1.88%	0.54%	A: 0.07%
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	24.20%	74.70%	1.12%	0.00%	NA
Indica I	595	92.30%	4.70%	2.69%	0.34%	NA
Indica II	465	90.10%	6.00%	1.72%	2.15%	NA
Indica III	913	97.80%	1.40%	0.66%	0.11%	NA
Indica Intermediate	786	90.30%	6.40%	2.80%	0.25%	A: 0.25%
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	41.10%	57.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127415010	T -> A	LOC_Os01g47890.1	upstream_gene_variant ; 2170.0bp to feature; MODIFIER	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg0127415010	T -> A	LOC_Os01g47900.1	downstream_gene_variant ; 2274.0bp to feature; MODIFIER	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg0127415010	T -> A	LOC_Os01g47890-LOC_Os01g47900	intergenic_region ; MODIFIER	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg0127415010	T -> DEL	N	N	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg0127415010	T -> C	LOC_Os01g47890.1	upstream_gene_variant ; 2170.0bp to feature; MODIFIER	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg0127415010	T -> C	LOC_Os01g47900.1	downstream_gene_variant ; 2274.0bp to feature; MODIFIER	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg0127415010	T -> C	LOC_Os01g47890-LOC_Os01g47900	intergenic_region ; MODIFIER	silent_mutation	Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127415010	NA	2.30E-21	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	6.75E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	7.69E-26	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	4.39E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	7.07E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	9.71E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	1.69E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	2.47E-30	mr1323_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	3.25E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	4.08E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	4.17E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	3.91E-25	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	5.17E-43	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	7.79E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010	NA	1.35E-58	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251