\
| Variant ID: vg0127415010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27415010 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 117. )
ATAAGGAATATTAGAAGTAGAGTATAGAGTTCATATAGAAATACAATTAGAAAATAACTGAAATTCGGAATTAAAAATAAGAAATATTAGAAGTAGAGTA[T/C,A]
AGAGTCCATATATAAAAACAATTAAGAAAAAAAATAGAAATTCGGAATTAAAAAGTAAGGAATATTATAAGTAGAGTGTAGAGTCTATATAGAAATTTAA
TTAAATTTCTATATAGACTCTACACTCTACTTATAATATTCCTTACTTTTTAATTCCGAATTTCTATTTTTTTTCTTAATTGTTTTTATATATGGACTCT[A/G,T]
TACTCTACTTCTAATATTTCTTATTTTTAATTCCGAATTTCAGTTATTTTCTAATTGTATTTCTATATGAACTCTATACTCTACTTCTAATATTCCTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 39.70% | 1.18% | 0.32% | A: 0.04% |
| All Indica | 2759 | 93.20% | 4.30% | 1.88% | 0.54% | A: 0.07% |
| All Japonica | 1512 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.20% | 74.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 92.30% | 4.70% | 2.69% | 0.34% | NA |
| Indica II | 465 | 90.10% | 6.00% | 1.72% | 2.15% | NA |
| Indica III | 913 | 97.80% | 1.40% | 0.66% | 0.11% | NA |
| Indica Intermediate | 786 | 90.30% | 6.40% | 2.80% | 0.25% | A: 0.25% |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 57.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127415010 | T -> A | LOC_Os01g47890.1 | upstream_gene_variant ; 2170.0bp to feature; MODIFIER | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| vg0127415010 | T -> A | LOC_Os01g47900.1 | downstream_gene_variant ; 2274.0bp to feature; MODIFIER | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| vg0127415010 | T -> A | LOC_Os01g47890-LOC_Os01g47900 | intergenic_region ; MODIFIER | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| vg0127415010 | T -> DEL | N | N | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| vg0127415010 | T -> C | LOC_Os01g47890.1 | upstream_gene_variant ; 2170.0bp to feature; MODIFIER | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| vg0127415010 | T -> C | LOC_Os01g47900.1 | downstream_gene_variant ; 2274.0bp to feature; MODIFIER | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| vg0127415010 | T -> C | LOC_Os01g47890-LOC_Os01g47900 | intergenic_region ; MODIFIER | silent_mutation | Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127415010 | NA | 2.30E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 6.75E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 7.69E-26 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 4.39E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 7.07E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 9.71E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 1.69E-08 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 2.47E-30 | mr1323_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 3.25E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 4.08E-14 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 4.17E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 3.91E-25 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 5.17E-43 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 7.79E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127415010 | NA | 1.35E-58 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |