\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127415010:

Variant ID: vg0127415010 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27415010
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGGAATATTAGAAGTAGAGTATAGAGTTCATATAGAAATACAATTAGAAAATAACTGAAATTCGGAATTAAAAATAAGAAATATTAGAAGTAGAGTA[T/C,A]
AGAGTCCATATATAAAAACAATTAAGAAAAAAAATAGAAATTCGGAATTAAAAAGTAAGGAATATTATAAGTAGAGTGTAGAGTCTATATAGAAATTTAA

Reverse complement sequence

TTAAATTTCTATATAGACTCTACACTCTACTTATAATATTCCTTACTTTTTAATTCCGAATTTCTATTTTTTTTCTTAATTGTTTTTATATATGGACTCT[A/G,T]
TACTCTACTTCTAATATTTCTTATTTTTAATTCCGAATTTCAGTTATTTTCTAATTGTATTTCTATATGAACTCTATACTCTACTTCTAATATTCCTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 39.70% 1.18% 0.32% A: 0.04%
All Indica  2759 93.20% 4.30% 1.88% 0.54% A: 0.07%
All Japonica  1512 1.10% 98.90% 0.00% 0.00% NA
Aus  269 24.20% 74.70% 1.12% 0.00% NA
Indica I  595 92.30% 4.70% 2.69% 0.34% NA
Indica II  465 90.10% 6.00% 1.72% 2.15% NA
Indica III  913 97.80% 1.40% 0.66% 0.11% NA
Indica Intermediate  786 90.30% 6.40% 2.80% 0.25% A: 0.25%
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127415010 T -> A LOC_Os01g47890.1 upstream_gene_variant ; 2170.0bp to feature; MODIFIER silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg0127415010 T -> A LOC_Os01g47900.1 downstream_gene_variant ; 2274.0bp to feature; MODIFIER silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg0127415010 T -> A LOC_Os01g47890-LOC_Os01g47900 intergenic_region ; MODIFIER silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg0127415010 T -> DEL N N silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg0127415010 T -> C LOC_Os01g47890.1 upstream_gene_variant ; 2170.0bp to feature; MODIFIER silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg0127415010 T -> C LOC_Os01g47900.1 downstream_gene_variant ; 2274.0bp to feature; MODIFIER silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg0127415010 T -> C LOC_Os01g47890-LOC_Os01g47900 intergenic_region ; MODIFIER silent_mutation Average:14.591; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127415010 NA 2.30E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 6.75E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 7.69E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 4.39E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 7.07E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 9.71E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 1.69E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 2.47E-30 mr1323_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 3.25E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 4.08E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 4.17E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 3.91E-25 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 5.17E-43 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 7.79E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127415010 NA 1.35E-58 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251