Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127364959:

Variant ID: vg0127364959 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27364959
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTTTATTTTTGAAGAGGAGAAGTTGAGAGAAGGAATGTGAAAACATTACATGAGATGTTAGGAAGATGCAGGTTTGTAAAGATATGGTTAATGGCTTT[A/T]
TGTGTCAATTTTTAGTCTTTGGAAGATCTTGCTGATTTTTCAAGCCACAGAAGGTTGGAAGGATACTTTTGCACTTTGCTGTCAAGCTAGACAAAATATG

Reverse complement sequence

CATATTTTGTCTAGCTTGACAGCAAAGTGCAAAAGTATCCTTCCAACCTTCTGTGGCTTGAAAAATCAGCAAGATCTTCCAAAGACTAAAAATTGACACA[T/A]
AAAGCCATTAACCATATCTTTACAAACCTGCATCTTCCTAACATCTCATGTAATGTTTTCACATTCCTTCTCTCAACTTCTCCTCTTCAAAAATAAACCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	44.40%	0.02%	0.00%	NA
All Indica	2759	92.80%	7.20%	0.04%	0.00%	NA
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	10.40%	89.60%	0.00%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	90.50%	9.50%	0.00%	0.00%	NA
Indica Intermediate	786	90.30%	9.50%	0.13%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	32.20%	67.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127364959	A -> T	LOC_Os01g47800.1	downstream_gene_variant ; 1098.0bp to feature; MODIFIER	silent_mutation	Average:47.846; most accessible tissue: Callus, score: 87.465	N	N	N	N
vg0127364959	A -> T	LOC_Os01g47810.1	downstream_gene_variant ; 1358.0bp to feature; MODIFIER	silent_mutation	Average:47.846; most accessible tissue: Callus, score: 87.465	N	N	N	N
vg0127364959	A -> T	LOC_Os01g47800-LOC_Os01g47810	intergenic_region ; MODIFIER	silent_mutation	Average:47.846; most accessible tissue: Callus, score: 87.465	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127364959	NA	5.05E-50	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.48E-58	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	9.31E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	2.00E-06	NA	mr1201	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	6.26E-29	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.66E-17	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	3.70E-06	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.35E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	7.66E-08	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	3.66E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	3.28E-65	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	3.62E-48	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.41E-44	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	3.72E-38	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.74E-62	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	2.55E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	7.24E-37	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.54E-57	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959	NA	1.04E-25	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251