\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127364959:

Variant ID: vg0127364959 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27364959
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTTATTTTTGAAGAGGAGAAGTTGAGAGAAGGAATGTGAAAACATTACATGAGATGTTAGGAAGATGCAGGTTTGTAAAGATATGGTTAATGGCTTT[A/T]
TGTGTCAATTTTTAGTCTTTGGAAGATCTTGCTGATTTTTCAAGCCACAGAAGGTTGGAAGGATACTTTTGCACTTTGCTGTCAAGCTAGACAAAATATG

Reverse complement sequence

CATATTTTGTCTAGCTTGACAGCAAAGTGCAAAAGTATCCTTCCAACCTTCTGTGGCTTGAAAAATCAGCAAGATCTTCCAAAGACTAAAAATTGACACA[T/A]
AAAGCCATTAACCATATCTTTACAAACCTGCATCTTCCTAACATCTCATGTAATGTTTTCACATTCCTTCTCTCAACTTCTCCTCTTCAAAAATAAACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 44.40% 0.02% 0.00% NA
All Indica  2759 92.80% 7.20% 0.04% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 90.50% 9.50% 0.00% 0.00% NA
Indica Intermediate  786 90.30% 9.50% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127364959 A -> T LOC_Os01g47800.1 downstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:47.846; most accessible tissue: Callus, score: 87.465 N N N N
vg0127364959 A -> T LOC_Os01g47810.1 downstream_gene_variant ; 1358.0bp to feature; MODIFIER silent_mutation Average:47.846; most accessible tissue: Callus, score: 87.465 N N N N
vg0127364959 A -> T LOC_Os01g47800-LOC_Os01g47810 intergenic_region ; MODIFIER silent_mutation Average:47.846; most accessible tissue: Callus, score: 87.465 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127364959 NA 5.05E-50 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.48E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 9.31E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 2.00E-06 NA mr1201 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 6.26E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.66E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 3.70E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.35E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 7.66E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 3.66E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 3.28E-65 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 3.62E-48 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.41E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 3.72E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.74E-62 mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 2.55E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 7.24E-37 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.54E-57 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127364959 NA 1.04E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251