\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127315416:

Variant ID: vg0127315416 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27315416
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATATAGATAAAAGAGAGAGAAATAACGTTAAGTAGTAGTAAAGTAAATCAATTTCAACAATCTGGGTGTAAAATAAGCGGAAAATATAGTTTAGAA[G/T]
GTTAGTGCTCTATAAACTAGTTCGAAGTAAAATATATCTTACACTATCTCTTGCTAAAACTACTCATCAGTAGTAGTTTTCCTTTTCCAAAATCTGGATT

Reverse complement sequence

AATCCAGATTTTGGAAAAGGAAAACTACTACTGATGAGTAGTTTTAGCAAGAGATAGTGTAAGATATATTTTACTTCGAACTAGTTTATAGAGCACTAAC[C/A]
TTCTAAACTATATTTTCCGCTTATTTTACACCCAGATTGTTGAAATTGATTTACTTTACTACTACTTAACGTTATTTCTCTCTCTTTTATCTATATAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.90% 5.80% 0.30% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 81.70% 17.40% 0.93% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 66.80% 31.70% 1.56% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 7.90% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127315416 G -> T LOC_Os01g47740.1 upstream_gene_variant ; 3108.0bp to feature; MODIFIER silent_mutation Average:31.727; most accessible tissue: Callus, score: 56.626 N N N N
vg0127315416 G -> T LOC_Os01g47740.4 upstream_gene_variant ; 3111.0bp to feature; MODIFIER silent_mutation Average:31.727; most accessible tissue: Callus, score: 56.626 N N N N
vg0127315416 G -> T LOC_Os01g47740.3 upstream_gene_variant ; 3108.0bp to feature; MODIFIER silent_mutation Average:31.727; most accessible tissue: Callus, score: 56.626 N N N N
vg0127315416 G -> T LOC_Os01g47745.1 downstream_gene_variant ; 983.0bp to feature; MODIFIER silent_mutation Average:31.727; most accessible tissue: Callus, score: 56.626 N N N N
vg0127315416 G -> T LOC_Os01g47750.1 downstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:31.727; most accessible tissue: Callus, score: 56.626 N N N N
vg0127315416 G -> T LOC_Os01g47745-LOC_Os01g47750 intergenic_region ; MODIFIER silent_mutation Average:31.727; most accessible tissue: Callus, score: 56.626 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127315416 3.38E-07 NA mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251