Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127278759:

Variant ID: vg0127278759 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27278759
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.30, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTGCTAAATTCTTACTAACACTGATATGTCATTCTATAAGTGCATCTAGATTTTATATAACTTTCATCTACTTAAATTAAACGGTTCAGATGATTG[A/T]
TAGTAAAAGTTTAGTAAGAAAAAATTAGTACGTGTACAAATCACGGATCGGGCTGTTATTATAGGTTGAACTAATCGTGTACCACTACCACTCCAGCTAA

Reverse complement sequence

TTAGCTGGAGTGGTAGTGGTACACGATTAGTTCAACCTATAATAACAGCCCGATCCGTGATTTGTACACGTACTAATTTTTTCTTACTAAACTTTTACTA[T/A]
CAATCATCTGAACCGTTTAATTTAAGTAGATGAAAGTTATATAAAATCTAGATGCACTTATAGAATGACATATCAGTGTTAGTAAGAATTTAGCAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.20% 0.30% 0.00% NA
All Indica  2759 95.20% 4.40% 0.43% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 68.80% 30.90% 0.37% 0.00% NA
Indica I  595 93.40% 5.90% 0.67% 0.00% NA
Indica II  465 94.40% 4.70% 0.86% 0.00% NA
Indica III  913 96.20% 3.50% 0.33% 0.00% NA
Indica Intermediate  786 95.80% 4.10% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 36.70% 62.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127278759 A -> T LOC_Os01g47680.1 upstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:96.234; most accessible tissue: Callus, score: 99.363 N N N N
vg0127278759 A -> T LOC_Os01g47690.1 upstream_gene_variant ; 199.0bp to feature; MODIFIER silent_mutation Average:96.234; most accessible tissue: Callus, score: 99.363 N N N N
vg0127278759 A -> T LOC_Os01g47700.1 upstream_gene_variant ; 2498.0bp to feature; MODIFIER silent_mutation Average:96.234; most accessible tissue: Callus, score: 99.363 N N N N
vg0127278759 A -> T LOC_Os01g47680.2 upstream_gene_variant ; 4828.0bp to feature; MODIFIER silent_mutation Average:96.234; most accessible tissue: Callus, score: 99.363 N N N N
vg0127278759 A -> T LOC_Os01g47690.2 upstream_gene_variant ; 199.0bp to feature; MODIFIER silent_mutation Average:96.234; most accessible tissue: Callus, score: 99.363 N N N N
vg0127278759 A -> T LOC_Os01g47690-LOC_Os01g47700 intergenic_region ; MODIFIER silent_mutation Average:96.234; most accessible tissue: Callus, score: 99.363 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0127278759 A T -0.01 -0.01 -0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127278759 NA 3.66E-42 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 2.66E-46 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 3.22E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 9.36E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 3.07E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.15E-30 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.28E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 2.86E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.41E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.06E-24 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.37E-12 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.88E-51 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 4.76E-06 4.33E-08 mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 1.80E-14 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 5.95E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127278759 NA 2.05E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251