RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0127208150:

Variant ID: vg0127208150 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27208150
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAAGCAAAAAAAAAAAAGAAAAATCAGAGATCGATACGGGCAAATCACAAAATCAAAGATCGATTAAAAACCCAATCACGACAAATATCATCCAGAGT[T/C]
CGTATCAAATCTAACCCAAATTTCCTCCTAAACCCAATCATGTGAAAAAATCGGGTCTTAAGAGACAACTTTATGGTATAAGACCGATTGAATCCAAGGA

Reverse complement sequence

TCCTTGGATTCAATCGGTCTTATACCATAAAGTTGTCTCTTAAGACCCGATTTTTTCACATGATTGGGTTTAGGAGGAAATTTGGGTTAGATTTGATACG[A/G]
ACTCTGGATGATATTTGTCGTGATTGGGTTTTTAATCGATCTTTGATTTTGTGATTTGCCCGTATCGATCTCTGATTTTTCTTTTTTTTTTTTGCTTTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	35.60%	0.32%	0.00%	NA
All Indica	2759	94.80%	5.10%	0.04%	0.00%	NA
All Japonica	1512	12.30%	87.00%	0.73%	0.00%	NA
Aus	269	67.70%	32.30%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	90.80%	9.20%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.70%	0.13%	0.00%	NA
Temperate Japonica	767	1.20%	98.60%	0.26%	0.00%	NA
Tropical Japonica	504	24.40%	75.00%	0.60%	0.00%	NA
Japonica Intermediate	241	22.40%	75.10%	2.49%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	38.90%	57.80%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127208150	T -> C	LOC_Os01g47560-LOC_Os01g47570	intergenic_region ; MODIFIER	silent_mutation	Average:17.355; most accessible tissue: Zhenshan97 flower, score: 22.37	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127208150	NA	8.87E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	5.03E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	9.60E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	1.16E-52	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	3.54E-06	7.84E-26	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	5.08E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	2.81E-06	3.76E-21	mr1679_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	5.86E-07	mr1691_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	1.19E-27	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208150	NA	2.00E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0127208150:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact