\
| Variant ID: vg0127208150 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27208150 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )
TCAAAGCAAAAAAAAAAAAGAAAAATCAGAGATCGATACGGGCAAATCACAAAATCAAAGATCGATTAAAAACCCAATCACGACAAATATCATCCAGAGT[T/C]
CGTATCAAATCTAACCCAAATTTCCTCCTAAACCCAATCATGTGAAAAAATCGGGTCTTAAGAGACAACTTTATGGTATAAGACCGATTGAATCCAAGGA
TCCTTGGATTCAATCGGTCTTATACCATAAAGTTGTCTCTTAAGACCCGATTTTTTCACATGATTGGGTTTAGGAGGAAATTTGGGTTAGATTTGATACG[A/G]
ACTCTGGATGATATTTGTCGTGATTGGGTTTTTAATCGATCTTTGATTTTGTGATTTGCCCGTATCGATCTCTGATTTTTCTTTTTTTTTTTTGCTTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.60% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 12.30% | 87.00% | 0.73% | 0.00% | NA |
| Aus | 269 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 24.40% | 75.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 22.40% | 75.10% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 57.80% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127208150 | T -> C | LOC_Os01g47560-LOC_Os01g47570 | intergenic_region ; MODIFIER | silent_mutation | Average:17.355; most accessible tissue: Zhenshan97 flower, score: 22.37 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127208150 | NA | 8.87E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 5.03E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 9.60E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 1.16E-52 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | 3.54E-06 | 7.84E-26 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 5.08E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | 2.81E-06 | 3.76E-21 | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 5.86E-07 | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 1.19E-27 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 2.00E-12 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 9.51E-16 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 1.19E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 1.84E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | 9.49E-06 | 3.95E-10 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 1.10E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | 7.85E-06 | 4.20E-10 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 3.02E-15 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127208150 | NA | 1.26E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |