\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127140857:

Variant ID: vg0127140857 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27140857
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTTGCATTGCAAGTAACTACAATATCGGATATCTTGAAAATCCAAGTATTGAAACCGGTGTAATTTACCCCCCCCCTAACGGTTTTGGAAAGCGGTTC[T/C]
ATTGATGTGGTGCTTTGACCCGGTCCAACTGGCTGACTCAGCGTGCGGGACCCACATGTCAGTGTCACATTTCTCTCACTTTCCCTCTCTCCTTTTCTAC

Reverse complement sequence

GTAGAAAAGGAGAGAGGGAAAGTGAGAGAAATGTGACACTGACATGTGGGTCCCGCACGCTGAGTCAGCCAGTTGGACCGGGTCAAAGCACCACATCAAT[A/G]
GAACCGCTTTCCAAAACCGTTAGGGGGGGGGTAAATTACACCGGTTTCAATACTTGGATTTTCAAGATATCCGATATTGTAGTTACTTGCAATGCAACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 9.40% 0.00% 0.00% NA
All Indica  2759 88.40% 11.60% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 82.50% 17.50% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 91.00% 9.00% 0.00% 0.00% NA
Indica Intermediate  786 84.20% 15.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127140857 T -> C LOC_Os01g47480.1 upstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:82.654; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0127140857 T -> C LOC_Os01g47490.1 upstream_gene_variant ; 4085.0bp to feature; MODIFIER silent_mutation Average:82.654; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0127140857 T -> C LOC_Os01g47490.5 upstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:82.654; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0127140857 T -> C LOC_Os01g47490.2 upstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:82.654; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0127140857 T -> C LOC_Os01g47490.3 upstream_gene_variant ; 4085.0bp to feature; MODIFIER silent_mutation Average:82.654; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0127140857 T -> C LOC_Os01g47470-LOC_Os01g47480 intergenic_region ; MODIFIER silent_mutation Average:82.654; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127140857 1.09E-06 1.09E-06 mr1061_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127140857 NA 9.46E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251