\
| Variant ID: vg0127135528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27135528 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )
CTAAATTTTCTTTAGAGACACATTACATGATTTGACGGTTGACGCCATACTATTTCGGCTAGATGAGTCTTCTCTAACGTACTATTCTCTAACGTGAGTT[A/C,T]
CTCACATGTGAACCTGTTAGTTGTGGAACCCATATATCATCAACTTAAAGTGAGAGGGTAGTATGGCGGCGGATCTGTTATCGTTCCTATTTCGATTGTA
TACAATCGAAATAGGAACGATAACAGATCCGCCGCCATACTACCCTCTCACTTTAAGTTGATGATATATGGGTTCCACAACTAACAGGTTCACATGTGAG[T/G,A]
AACTCACGTTAGAGAATAGTACGTTAGAGAAGACTCATCTAGCCGAAATAGTATGGCGTCAACCGTCAAATCATGTAATGTGTCTCTAAAGAAAATTTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.90% | 0.80% | 0.17% | 0.00% | T: 0.11% |
| All Indica | 2759 | 99.90% | 0.00% | 0.00% | 0.00% | T: 0.07% |
| All Japonica | 1512 | 96.90% | 2.50% | 0.53% | 0.00% | T: 0.07% |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.00% | T: 0.37% |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.00% | 0.00% | T: 0.25% |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 7.50% | 0.99% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 0.00% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127135528 | A -> T | LOC_Os01g47470.1 | upstream_gene_variant ; 1334.0bp to feature; MODIFIER | silent_mutation | Average:62.079; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| vg0127135528 | A -> T | LOC_Os01g47470-LOC_Os01g47480 | intergenic_region ; MODIFIER | silent_mutation | Average:62.079; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| vg0127135528 | A -> C | LOC_Os01g47470.1 | upstream_gene_variant ; 1334.0bp to feature; MODIFIER | silent_mutation | Average:62.079; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| vg0127135528 | A -> C | LOC_Os01g47470-LOC_Os01g47480 | intergenic_region ; MODIFIER | silent_mutation | Average:62.079; most accessible tissue: Callus, score: 89.305 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127135528 | 6.16E-06 | 6.15E-06 | mr1159_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 4.67E-08 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | 1.70E-06 | 1.70E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | 3.43E-06 | 3.43E-06 | mr1470_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 5.04E-06 | mr1556_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 2.89E-06 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 2.80E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 2.06E-07 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | 6.42E-06 | 1.00E-06 | mr1759_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 6.01E-06 | mr1764_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | NA | 2.52E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | 7.60E-06 | 7.59E-06 | mr1811_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127135528 | 3.05E-06 | 3.05E-06 | mr1847_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |