\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127135528:

Variant ID: vg0127135528 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27135528
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAATTTTCTTTAGAGACACATTACATGATTTGACGGTTGACGCCATACTATTTCGGCTAGATGAGTCTTCTCTAACGTACTATTCTCTAACGTGAGTT[A/C,T]
CTCACATGTGAACCTGTTAGTTGTGGAACCCATATATCATCAACTTAAAGTGAGAGGGTAGTATGGCGGCGGATCTGTTATCGTTCCTATTTCGATTGTA

Reverse complement sequence

TACAATCGAAATAGGAACGATAACAGATCCGCCGCCATACTACCCTCTCACTTTAAGTTGATGATATATGGGTTCCACAACTAACAGGTTCACATGTGAG[T/G,A]
AACTCACGTTAGAGAATAGTACGTTAGAGAAGACTCATCTAGCCGAAATAGTATGGCGTCAACCGTCAAATCATGTAATGTGTCTCTAAAGAAAATTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.90% 0.80% 0.17% 0.00% T: 0.11%
All Indica  2759 99.90% 0.00% 0.00% 0.00% T: 0.07%
All Japonica  1512 96.90% 2.50% 0.53% 0.00% T: 0.07%
Aus  269 99.60% 0.00% 0.00% 0.00% T: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.00% 0.00% T: 0.25%
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 91.30% 7.50% 0.99% 0.00% T: 0.20%
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 0.00% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127135528 A -> T LOC_Os01g47470.1 upstream_gene_variant ; 1334.0bp to feature; MODIFIER silent_mutation Average:62.079; most accessible tissue: Callus, score: 89.305 N N N N
vg0127135528 A -> T LOC_Os01g47470-LOC_Os01g47480 intergenic_region ; MODIFIER silent_mutation Average:62.079; most accessible tissue: Callus, score: 89.305 N N N N
vg0127135528 A -> C LOC_Os01g47470.1 upstream_gene_variant ; 1334.0bp to feature; MODIFIER silent_mutation Average:62.079; most accessible tissue: Callus, score: 89.305 N N N N
vg0127135528 A -> C LOC_Os01g47470-LOC_Os01g47480 intergenic_region ; MODIFIER silent_mutation Average:62.079; most accessible tissue: Callus, score: 89.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127135528 6.16E-06 6.15E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 4.67E-08 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 1.70E-06 1.70E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 3.43E-06 3.43E-06 mr1470_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 5.04E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 2.89E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 2.80E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 2.06E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 6.42E-06 1.00E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 6.01E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 NA 2.52E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 7.60E-06 7.59E-06 mr1811_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127135528 3.05E-06 3.05E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251