\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127046677:

Variant ID: vg0127046677 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27046677
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTGTACCGGCGCTCCCCGCTGGCCAGCCTCCACGTGTCACCACCGGCCGCGCCTCGTTGTACCGCACCGGCACACGCCTCGCCGGCTTCCGTCTCTGC[C/T]
GACCTCGCCTCCCACTGCGCTAGCTGCACCTCCTCACGTCGCGCCGGCCTCTGCCACGCCTCCTTGCGCCGCGACCGTGCGCAAGCCGCGCCTCACCGGC

Reverse complement sequence

GCCGGTGAGGCGCGGCTTGCGCACGGTCGCGGCGCAAGGAGGCGTGGCAGAGGCCGGCGCGACGTGAGGAGGTGCAGCTAGCGCAGTGGGAGGCGAGGTC[G/A]
GCAGAGACGGAAGCCGGCGAGGCGTGTGCCGGTGCGGTACAACGAGGCGCGGCCGGTGGTGACACGTGGAGGCTGGCCAGCGGGGAGCGCCGGTACAGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.40% 0.02% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 15.60% 84.40% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127046677 C -> T LOC_Os01g47330.1 downstream_gene_variant ; 4008.0bp to feature; MODIFIER silent_mutation Average:96.14; most accessible tissue: Minghui63 flag leaf, score: 98.41 N N N N
vg0127046677 C -> T LOC_Os01g47340.1 downstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:96.14; most accessible tissue: Minghui63 flag leaf, score: 98.41 N N N N
vg0127046677 C -> T LOC_Os01g47350.1 downstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:96.14; most accessible tissue: Minghui63 flag leaf, score: 98.41 N N N N
vg0127046677 C -> T LOC_Os01g47340.2 downstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:96.14; most accessible tissue: Minghui63 flag leaf, score: 98.41 N N N N
vg0127046677 C -> T LOC_Os01g47330-LOC_Os01g47340 intergenic_region ; MODIFIER silent_mutation Average:96.14; most accessible tissue: Minghui63 flag leaf, score: 98.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0127046677 C T 0.04 0.01 0.0 0.03 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127046677 NA 4.40E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 2.02E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 6.85E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 2.28E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 1.23E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 3.64E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 7.18E-26 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 1.80E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 2.25E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 NA 8.54E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 4.37E-06 4.37E-06 mr1659_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127046677 5.99E-06 NA mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251