\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127041564:

Variant ID: vg0127041564 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27041564
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTGGGGGAGAATAGTTTCTTCATAATAGATAAAGAATAAATATGATTGGTAGAGAAGAGAGATGATGTATTTATTAATGGTCCACTTTAAGAAACCAT[A/G]
AGTTATGGAGTGTAATTTTTATTGTGATGTCTTATTGACATGGTACCATATACACTACCTTTAAACGCTATGGTTTGGGACTGCTCTCATGTATTATATC

Reverse complement sequence

GATATAATACATGAGAGCAGTCCCAAACCATAGCGTTTAAAGGTAGTGTATATGGTACCATGTCAATAAGACATCACAATAAAAATTACACTCCATAACT[T/C]
ATGGTTTCTTAAAGTGGACCATTAATAAATACATCATCTCTCTTCTCTACCAATCATATTTATTCTTTATCTATTATGAAGAAACTATTCTCCCCCAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.80% 0.40% 0.34% NA
All Indica  2759 98.00% 1.90% 0.04% 0.04% NA
All Japonica  1512 85.20% 14.70% 0.07% 0.00% NA
Aus  269 60.20% 28.60% 5.95% 5.20% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.20% 0.13% 0.13% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 59.10% 40.90% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127041564 A -> G LOC_Os01g47330.1 upstream_gene_variant ; 227.0bp to feature; MODIFIER silent_mutation Average:80.63; most accessible tissue: Callus, score: 93.129 N N N N
vg0127041564 A -> G LOC_Os01g47310.1 downstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:80.63; most accessible tissue: Callus, score: 93.129 N N N N
vg0127041564 A -> G LOC_Os01g47310-LOC_Os01g47330 intergenic_region ; MODIFIER silent_mutation Average:80.63; most accessible tissue: Callus, score: 93.129 N N N N
vg0127041564 A -> DEL N N silent_mutation Average:80.63; most accessible tissue: Callus, score: 93.129 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0127041564 A G -0.01 -0.02 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127041564 NA 9.30E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 8.07E-07 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 5.90E-07 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 4.74E-06 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 9.09E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 1.58E-14 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 6.73E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 2.27E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 1.52E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 1.94E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 9.44E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127041564 NA 6.16E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251