\
| Variant ID: vg0127040944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27040944 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAGTTTTGTGGTTCCGGGGGGAGGGGTAATTCATACTGTCACAGTAGTTCGGAGGGTAATTCGTACTTTTTCCTTCATAATATAAGGCCTGCATGCATG[C/A,T]
ATGGCAATTAATTATCATATCTTCTATCTTACATTATTATTTTTTAAATCATACACTCACAAGATGTTTAATTCTATTGGGTGCATATATTGTATTAGTT
AACTAATACAATATATGCACCCAATAGAATTAAACATCTTGTGAGTGTATGATTTAAAAAATAATAATGTAAGATAGAAGATATGATAATTAATTGCCAT[G/T,A]
CATGCATGCAGGCCTTATATTATGAAGGAAAAAGTACGAATTACCCTCCGAACTACTGTGACAGTATGAATTACCCCTCCCCCCGGAACCACAAAACTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 5.20% | 0.00% | 0.00% | A: 2.88% |
| All Indica | 2759 | 98.90% | 0.50% | 0.00% | 0.00% | A: 0.58% |
| All Japonica | 1512 | 85.20% | 14.60% | 0.00% | 0.00% | A: 0.20% |
| Aus | 269 | 58.70% | 0.00% | 0.00% | 0.00% | A: 41.26% |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.00% | A: 0.17% |
| Indica II | 465 | 97.80% | 1.90% | 0.00% | 0.00% | A: 0.22% |
| Indica III | 913 | 99.20% | 0.00% | 0.00% | 0.00% | A: 0.77% |
| Indica Intermediate | 786 | 98.30% | 0.80% | 0.00% | 0.00% | A: 0.89% |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 5.80% | 0.00% | 0.00% | A: 1.24% |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 0.00% | A: 4.17% |
| Intermediate | 90 | 87.80% | 10.00% | 0.00% | 0.00% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127040944 | C -> T | LOC_Os01g47330.1 | upstream_gene_variant ; 847.0bp to feature; MODIFIER | silent_mutation | Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0127040944 | C -> T | LOC_Os01g47310.1 | downstream_gene_variant ; 2361.0bp to feature; MODIFIER | silent_mutation | Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0127040944 | C -> T | LOC_Os01g47310-LOC_Os01g47330 | intergenic_region ; MODIFIER | silent_mutation | Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0127040944 | C -> A | LOC_Os01g47330.1 | upstream_gene_variant ; 847.0bp to feature; MODIFIER | silent_mutation | Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0127040944 | C -> A | LOC_Os01g47310.1 | downstream_gene_variant ; 2361.0bp to feature; MODIFIER | silent_mutation | Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0127040944 | C -> A | LOC_Os01g47310-LOC_Os01g47330 | intergenic_region ; MODIFIER | silent_mutation | Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127040944 | NA | 4.13E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 2.82E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 4.17E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 1.01E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 6.59E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 3.54E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 4.94E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 7.15E-07 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | 4.99E-06 | 4.99E-06 | mr1659_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 2.51E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | NA | 4.45E-06 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127040944 | 8.71E-07 | 9.18E-10 | mr1916_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |