\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127040944:

Variant ID: vg0127040944 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27040944
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGTTTTGTGGTTCCGGGGGGAGGGGTAATTCATACTGTCACAGTAGTTCGGAGGGTAATTCGTACTTTTTCCTTCATAATATAAGGCCTGCATGCATG[C/A,T]
ATGGCAATTAATTATCATATCTTCTATCTTACATTATTATTTTTTAAATCATACACTCACAAGATGTTTAATTCTATTGGGTGCATATATTGTATTAGTT

Reverse complement sequence

AACTAATACAATATATGCACCCAATAGAATTAAACATCTTGTGAGTGTATGATTTAAAAAATAATAATGTAAGATAGAAGATATGATAATTAATTGCCAT[G/T,A]
CATGCATGCAGGCCTTATATTATGAAGGAAAAAGTACGAATTACCCTCCGAACTACTGTGACAGTATGAATTACCCCTCCCCCCGGAACCACAAAACTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 5.20% 0.00% 0.00% A: 2.88%
All Indica  2759 98.90% 0.50% 0.00% 0.00% A: 0.58%
All Japonica  1512 85.20% 14.60% 0.00% 0.00% A: 0.20%
Aus  269 58.70% 0.00% 0.00% 0.00% A: 41.26%
Indica I  595 99.80% 0.00% 0.00% 0.00% A: 0.17%
Indica II  465 97.80% 1.90% 0.00% 0.00% A: 0.22%
Indica III  913 99.20% 0.00% 0.00% 0.00% A: 0.77%
Indica Intermediate  786 98.30% 0.80% 0.00% 0.00% A: 0.89%
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 59.30% 40.70% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 5.80% 0.00% 0.00% A: 1.24%
VI/Aromatic  96 95.80% 0.00% 0.00% 0.00% A: 4.17%
Intermediate  90 87.80% 10.00% 0.00% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127040944 C -> T LOC_Os01g47330.1 upstream_gene_variant ; 847.0bp to feature; MODIFIER silent_mutation Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0127040944 C -> T LOC_Os01g47310.1 downstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0127040944 C -> T LOC_Os01g47310-LOC_Os01g47330 intergenic_region ; MODIFIER silent_mutation Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0127040944 C -> A LOC_Os01g47330.1 upstream_gene_variant ; 847.0bp to feature; MODIFIER silent_mutation Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0127040944 C -> A LOC_Os01g47310.1 downstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0127040944 C -> A LOC_Os01g47310-LOC_Os01g47330 intergenic_region ; MODIFIER silent_mutation Average:45.532; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127040944 NA 4.13E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 2.82E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 4.17E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 1.01E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 6.59E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 3.54E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 4.94E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 7.15E-07 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 4.99E-06 4.99E-06 mr1659_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 2.51E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 NA 4.45E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127040944 8.71E-07 9.18E-10 mr1916_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251