\
| Variant ID: vg0127027003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27027003 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, C: 0.44, others allele: 0.00, population size: 103. )
AACAAGCAAGAACAAGATAAAAGCAATCTGATATTGCAAATAGGAATGAATACACACGATAAGTTGGGGTTCCGAAGAACAAGCAGACGGGCGGTCTAGC[T/C]
GACACGCGAGCTGCAAGCAAGTAGCAATGGCTAAACTTTAATCTAACAAAACCCAATAAACCCTGAAGGAGTACCTAGCTATATATAGGGGTGGGAGGAC
GTCCTCCCACCCCTATATATAGCTAGGTACTCCTTCAGGGTTTATTGGGTTTTGTTAGATTAAAGTTTAGCCATTGCTACTTGCTTGCAGCTCGCGTGTC[A/G]
GCTAGACCGCCCGTCTGCTTGTTCTTCGGAACCCCAACTTATCGTGTGTATTCATTCCTATTTGCAATATCAGATTGCTTTTATCTTGTTCTTGCTTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 35.80% | 1.57% | 0.91% | NA |
| All Indica | 2759 | 97.90% | 1.60% | 0.47% | 0.11% | NA |
| All Japonica | 1512 | 4.00% | 95.80% | 0.07% | 0.13% | NA |
| Aus | 269 | 45.00% | 20.80% | 21.19% | 13.01% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.70% | 0.70% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 3.30% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.90% | 89.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 97.90% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 4.20% | 91.70% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 36.70% | 61.10% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127027003 | T -> DEL | N | N | silent_mutation | Average:54.91; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0127027003 | T -> C | LOC_Os01g47290.1 | upstream_gene_variant ; 4776.0bp to feature; MODIFIER | silent_mutation | Average:54.91; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0127027003 | T -> C | LOC_Os01g47280-LOC_Os01g47290 | intergenic_region ; MODIFIER | silent_mutation | Average:54.91; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127027003 | NA | 3.23E-22 | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | NA | 1.71E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | NA | 1.51E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | NA | 1.92E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | NA | 3.35E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | 9.00E-07 | 1.41E-18 | mr1416_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | NA | 1.55E-12 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127027003 | NA | 1.24E-21 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |