\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126828419:

Variant ID: vg0126828419 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26828419
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ACGTTCATCTCAGTCACTGTCGTTTGACCGATCATATATTCTGTTACAAGTAATGGATGCATTTCTATTACTCCTTCCGTACCATAATATAAGATATTTT[A/G]
AGTTTTTATTTGCAATGTTTAACCACTCGTCTTATTTAATTTTTTTTAAAATTATTATTTATTTTATTTGTGACTTATTTTATTATCCACAGTACTTTAA

Reverse complement sequence

TTAAAGTACTGTGGATAATAAAATAAGTCACAAATAAAATAAATAATAATTTTAAAAAAAATTAAATAAGACGAGTGGTTAAACATTGCAAATAAAAACT[T/C]
AAAATATCTTATATTATGGTACGGAAGGAGTAATAGAAATGCATCCATTACTTGTAACAGAATATATGATCGGTCAAACGACAGTGACTGAGATGAACGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.70% 0.21% 0.02% NA
All Indica  2759 93.20% 6.60% 0.14% 0.04% NA
All Japonica  1512 4.10% 95.80% 0.07% 0.00% NA
Aus  269 39.00% 59.90% 1.12% 0.00% NA
Indica I  595 83.90% 16.10% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 95.90% 3.80% 0.22% 0.00% NA
Indica Intermediate  786 94.70% 5.00% 0.25% 0.13% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 33.30% 64.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126828419 A -> G LOC_Os01g46984.1 upstream_gene_variant ; 4568.0bp to feature; MODIFIER silent_mutation Average:51.109; most accessible tissue: Callus, score: 84.269 N N N N
vg0126828419 A -> G LOC_Os01g46990.1 downstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:51.109; most accessible tissue: Callus, score: 84.269 N N N N
vg0126828419 A -> G LOC_Os01g46984-LOC_Os01g46990 intergenic_region ; MODIFIER silent_mutation Average:51.109; most accessible tissue: Callus, score: 84.269 N N N N
vg0126828419 A -> DEL N N silent_mutation Average:51.109; most accessible tissue: Callus, score: 84.269 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126828419 NA 5.25E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 1.18E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 1.70E-29 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 3.90E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 1.74E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 1.30E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 6.94E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 5.33E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 2.89E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 3.75E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 1.82E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126828419 NA 1.46E-24 mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251