\
| Variant ID: vg0126828419 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26828419 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 111. )
ACGTTCATCTCAGTCACTGTCGTTTGACCGATCATATATTCTGTTACAAGTAATGGATGCATTTCTATTACTCCTTCCGTACCATAATATAAGATATTTT[A/G]
AGTTTTTATTTGCAATGTTTAACCACTCGTCTTATTTAATTTTTTTTAAAATTATTATTTATTTTATTTGTGACTTATTTTATTATCCACAGTACTTTAA
TTAAAGTACTGTGGATAATAAAATAAGTCACAAATAAAATAAATAATAATTTTAAAAAAAATTAAATAAGACGAGTGGTTAAACATTGCAAATAAAAACT[T/C]
AAAATATCTTATATTATGGTACGGAAGGAGTAATAGAAATGCATCCATTACTTGTAACAGAATATATGATCGGTCAAACGACAGTGACTGAGATGAACGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.70% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 93.20% | 6.60% | 0.14% | 0.04% | NA |
| All Japonica | 1512 | 4.10% | 95.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 39.00% | 59.90% | 1.12% | 0.00% | NA |
| Indica I | 595 | 83.90% | 16.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.90% | 3.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.50% | 89.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 64.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126828419 | A -> G | LOC_Os01g46984.1 | upstream_gene_variant ; 4568.0bp to feature; MODIFIER | silent_mutation | Average:51.109; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg0126828419 | A -> G | LOC_Os01g46990.1 | downstream_gene_variant ; 657.0bp to feature; MODIFIER | silent_mutation | Average:51.109; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg0126828419 | A -> G | LOC_Os01g46984-LOC_Os01g46990 | intergenic_region ; MODIFIER | silent_mutation | Average:51.109; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg0126828419 | A -> DEL | N | N | silent_mutation | Average:51.109; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126828419 | NA | 5.25E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 1.18E-25 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 1.70E-29 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 3.90E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 1.74E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 1.30E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 6.94E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 5.33E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 2.89E-14 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 3.75E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 1.82E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126828419 | NA | 1.46E-24 | mr1922_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |