\
| Variant ID: vg0126646322 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26646322 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 300. )
GGCTATCTTTATTCGACCCCACCACTGCTTGAGCCTCCCTGGCCCGGTGGATCCAGATCCTCTGCCTTTAGGGGAAAAAGGTAGAGACGCACGATGAAAT[G/A]
AGTCTGTTGCTACAGTAGAAAACAATGTTTTGCAGTTTTTCACTGTGCATAATAGTGAAATGTATTGTTCATAGTTACTATTCACGAATCGTTGTAGCGA
TCGCTACAACGATTCGTGAATAGTAACTATGAACAATACATTTCACTATTATGCACAGTGAAAAACTGCAAAACATTGTTTTCTACTGTAGCAACAGACT[C/T]
ATTTCATCGTGCGTCTCTACCTTTTTCCCCTAAAGGCAGAGGATCTGGATCCACCGGGCCAGGGAGGCTCAAGCAGTGGTGGGGTCGAATAAAGATAGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 9.10% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 0.70% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 73.60% | 26.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.20% | 1.01% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 0.80% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 45.80% | 53.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.50% | 48.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126646322 | G -> A | LOC_Os01g46750-LOC_Os01g46760 | intergenic_region ; MODIFIER | silent_mutation | Average:56.775; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126646322 | NA | 4.83E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 1.79E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 3.04E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 5.20E-08 | mr1382 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 5.17E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 1.03E-08 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 9.96E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 5.02E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 1.86E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 4.01E-10 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 3.98E-09 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 3.75E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 9.11E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 1.75E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 7.68E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126646322 | NA | 1.20E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |