\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126640706:

Variant ID: vg0126640706 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26640706
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.22, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CCGACCTCTCTTGCACTTCGAGTTCCTCCTCAGAAGGACGGAAGTTCTTCACGACCTCTCTTGCACTTCGAGTTCCTCCTCCTCTGTTCTTGAGCTGCAG[A/G]
ATCCTTCCTCGGTTCTGTTCACCTGCGCGCACAGGTGTACGGGACGAGCAGGTGCCTCCGAAACTCTGTCCGCTTGAGAACCTGCACGGGTAGGCGGACG

Reverse complement sequence

CGTCCGCCTACCCGTGCAGGTTCTCAAGCGGACAGAGTTTCGGAGGCACCTGCTCGTCCCGTACACCTGTGCGCGCAGGTGAACAGAACCGAGGAAGGAT[T/C]
CTGCAGCTCAAGAACAGAGGAGGAGGAACTCGAAGTGCAAGAGAGGTCGTGAAGAACTTCCGTCCTTCTGAGGAGGAACTCGAAGTGCAAGAGAGGTCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.10% 0.00% 0.00% NA
All Indica  2759 92.70% 7.30% 0.00% 0.00% NA
All Japonica  1512 96.00% 4.00% 0.00% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 91.10% 8.90% 0.00% 0.00% NA
Indica Intermediate  786 88.20% 11.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 89.10% 10.90% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126640706 A -> G LOC_Os01g46750.1 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0126640706 A -> G LOC_Os01g46750.2 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0126640706 A -> G LOC_Os01g46750.4 downstream_gene_variant ; 3757.0bp to feature; MODIFIER silent_mutation Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0126640706 A -> G LOC_Os01g46750-LOC_Os01g46760 intergenic_region ; MODIFIER silent_mutation Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126640706 NA 5.36E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 8.43E-08 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 7.17E-07 7.32E-10 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 4.03E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 2.84E-17 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 5.54E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 2.44E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 1.16E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 9.06E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706 NA 1.10E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251