Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126640706:

Variant ID: vg0126640706 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26640706
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.22, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

CCGACCTCTCTTGCACTTCGAGTTCCTCCTCAGAAGGACGGAAGTTCTTCACGACCTCTCTTGCACTTCGAGTTCCTCCTCCTCTGTTCTTGAGCTGCAG[A/G]
ATCCTTCCTCGGTTCTGTTCACCTGCGCGCACAGGTGTACGGGACGAGCAGGTGCCTCCGAAACTCTGTCCGCTTGAGAACCTGCACGGGTAGGCGGACG

Reverse complement sequence

CGTCCGCCTACCCGTGCAGGTTCTCAAGCGGACAGAGTTTCGGAGGCACCTGCTCGTCCCGTACACCTGTGCGCGCAGGTGAACAGAACCGAGGAAGGAT[T/C]
CTGCAGCTCAAGAACAGAGGAGGAGGAACTCGAAGTGCAAGAGAGGTCGTGAAGAACTTCCGTCCTTCTGAGGAGGAACTCGAAGTGCAAGAGAGGTCGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.10%	0.00%	0.00%	NA
All Indica	2759	92.70%	7.30%	0.00%	0.00%	NA
All Japonica	1512	96.00%	4.00%	0.00%	0.00%	NA
Aus	269	18.60%	81.40%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	91.10%	8.90%	0.00%	0.00%	NA
Indica Intermediate	786	88.20%	11.80%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	89.10%	10.90%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126640706	A -> G	LOC_Os01g46750.1	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0126640706	A -> G	LOC_Os01g46750.2	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0126640706	A -> G	LOC_Os01g46750.4	downstream_gene_variant ; 3757.0bp to feature; MODIFIER	silent_mutation	Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0126640706	A -> G	LOC_Os01g46750-LOC_Os01g46760	intergenic_region ; MODIFIER	silent_mutation	Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126640706	NA	5.36E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	8.43E-08	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	7.17E-07	7.32E-10	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	4.03E-06	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	2.84E-17	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	5.54E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	2.44E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	1.16E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	9.06E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126640706	NA	1.10E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251