\
| Variant ID: vg0126640706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26640706 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.22, others allele: 0.00, population size: 195. )
CCGACCTCTCTTGCACTTCGAGTTCCTCCTCAGAAGGACGGAAGTTCTTCACGACCTCTCTTGCACTTCGAGTTCCTCCTCCTCTGTTCTTGAGCTGCAG[A/G]
ATCCTTCCTCGGTTCTGTTCACCTGCGCGCACAGGTGTACGGGACGAGCAGGTGCCTCCGAAACTCTGTCCGCTTGAGAACCTGCACGGGTAGGCGGACG
CGTCCGCCTACCCGTGCAGGTTCTCAAGCGGACAGAGTTTCGGAGGCACCTGCTCGTCCCGTACACCTGTGCGCGCAGGTGAACAGAACCGAGGAAGGAT[T/C]
CTGCAGCTCAAGAACAGAGGAGGAGGAACTCGAAGTGCAAGAGAGGTCGTGAAGAACTTCCGTCCTTCTGAGGAGGAACTCGAAGTGCAAGAGAGGTCGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 18.60% | 81.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126640706 | A -> G | LOC_Os01g46750.1 | downstream_gene_variant ; 3757.0bp to feature; MODIFIER | silent_mutation | Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0126640706 | A -> G | LOC_Os01g46750.2 | downstream_gene_variant ; 3757.0bp to feature; MODIFIER | silent_mutation | Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0126640706 | A -> G | LOC_Os01g46750.4 | downstream_gene_variant ; 3757.0bp to feature; MODIFIER | silent_mutation | Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0126640706 | A -> G | LOC_Os01g46750-LOC_Os01g46760 | intergenic_region ; MODIFIER | silent_mutation | Average:49.041; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126640706 | NA | 5.36E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 8.43E-08 | mr1341_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | 7.17E-07 | 7.32E-10 | mr1363_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 4.03E-06 | mr1469_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 2.84E-17 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 5.54E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 2.44E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 1.16E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 9.06E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126640706 | NA | 1.10E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |