\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126514398:

Variant ID: vg0126514398 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 26514398
Reference Allele: GAATGGTCAlternative Allele: AAATGGTC,G
Primary Allele: GAATGGTCSecondary Allele: AAATGGTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAATATGTAAGACTATACGTGTACATAAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTACTTAAATTTTTTAAATAAGAC[GAATGGTC/AAATGGTC,G]
AAATACGTACTTAAAAAGTCGTGTCAAACGGAGGGACTTGAGTTGTAGTAAGGGCTGTCCCCCTCCTCCAGGCCCGCTGCGCTGAGGCGCTGAGCTGAGG

Reverse complement sequence

CCTCAGCTCAGCGCCTCAGCGCAGCGGGCCTGGAGGAGGGGGACAGCCCTTACTACAACTCAAGTCCCTCCGTTTGACACGACTTTTTAAGTACGTATTT[GACCATTC/GACCATTT,C]
GTCTTATTTAAAAAATTTAAGTAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTTATGTACACGTATAGTCTTACATATTTTAT

Allele Frequencies:

Populations Population SizeFrequency of GAATGGTC(primary allele) Frequency of AAATGGTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 8.00% 1.18% 0.00% G: 0.02%
All Indica  2759 99.30% 0.20% 0.40% 0.00% G: 0.04%
All Japonica  1512 73.10% 24.10% 2.84% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.00% 0.86% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 0.40% 0.76% 0.00% G: 0.13%
Temperate Japonica  767 98.00% 0.50% 1.43% 0.00% NA
Tropical Japonica  504 39.50% 57.30% 3.17% 0.00% NA
Japonica Intermediate  241 63.90% 29.50% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126514398 GAATGGTC -> G LOC_Os01g46570.1 upstream_gene_variant ; 144.0bp to feature; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> G LOC_Os01g46570.2 upstream_gene_variant ; 144.0bp to feature; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> G LOC_Os01g46570.3 upstream_gene_variant ; 2500.0bp to feature; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> G LOC_Os01g46554-LOC_Os01g46570 intergenic_region ; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> AAATGGTC LOC_Os01g46570.1 upstream_gene_variant ; 145.0bp to feature; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> AAATGGTC LOC_Os01g46570.2 upstream_gene_variant ; 145.0bp to feature; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> AAATGGTC LOC_Os01g46570.3 upstream_gene_variant ; 2501.0bp to feature; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N
vg0126514398 GAATGGTC -> AAATGGTC LOC_Os01g46554-LOC_Os01g46570 intergenic_region ; MODIFIER silent_mutation Average:89.765; most accessible tissue: Zhenshan97 panicle, score: 94.88 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0126514398 GAATG* AAATG* -0.04 -0.02 -0.02 -0.04 -0.04 -0.04
vg0126514398 GAATG* G -0.21 -0.2 -0.07 -0.13 -0.08 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126514398 3.58E-07 6.78E-06 mr1159_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 8.87E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 9.88E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.24E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.18E-09 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 4.29E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 3.99E-09 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.20E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.12E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 8.80E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.29E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 2.01E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 8.10E-06 1.36E-06 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 8.00E-10 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.61E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 3.84E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 8.22E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 2.03E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 9.00E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 6.90E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.12E-12 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.46E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 2.34E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 5.07E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 1.13E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126514398 NA 5.29E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251