\
| Variant ID: vg0126439651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26439651 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAATTATCAGTTTGCTGCAACATTAGCGATATATTTCAGTTTGCTGCAACATTAGCGACATATTTCAGTTTGCTACAACATTAGAGTGGGAAATTATCA[C/T]
AAAACATAACGTAAAAGTTGCAGTTTTGTGATAATTTCCCACGCTATTGTTGTAGCAAACCGAAACATGTCGCTAATGTTGCAGCAAACTAATAATTTTG
CAAAATTATTAGTTTGCTGCAACATTAGCGACATGTTTCGGTTTGCTACAACAATAGCGTGGGAAATTATCACAAAACTGCAACTTTTACGTTATGTTTT[G/A]
TGATAATTTCCCACTCTAATGTTGTAGCAAACTGAAATATGTCGCTAATGTTGCAGCAAACTGAAATATATCGCTAATGTTGCAGCAAACTGATAATTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 7.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 12.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 67.10% | 32.50% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126439651 | C -> T | LOC_Os01g46470-LOC_Os01g46490 | intergenic_region ; MODIFIER | silent_mutation | Average:44.689; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126439651 | NA | 7.54E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 6.28E-08 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 2.45E-08 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | 7.10E-06 | 7.09E-06 | mr1208 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 2.13E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 2.45E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | 4.23E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | 4.26E-07 | 9.46E-10 | mr1596 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 9.78E-08 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 3.73E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126439651 | NA | 1.90E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |