\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126418162:

Variant ID: vg0126418162 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26418162
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGACCCCAAACCACAAAACTGGATATCTTGACCCCCAAATTCTTAAAATCGGTGCAATTTGACTCCCTGAGCGGTTTTGCTGACGTGGCGCTTACGTG[G/T,A]
CAGTATTGACTCGGTCTTCTTTCCACGTCGCGTTGACGTGGCGTTGAGGTGTCATTAGAAATTAAAAAAAATGCGTGGGACCCATCTGTCATTCACACAC

Reverse complement sequence

GTGTGTGAATGACAGATGGGTCCCACGCATTTTTTTTAATTTCTAATGACACCTCAACGCCACGTCAACGCGACGTGGAAAGAAGACCGAGTCAATACTG[C/A,T]
CACGTAAGCGCCACGTCAGCAAAACCGCTCAGGGAGTCAAATTGCACCGATTTTAAGAATTTGGGGGTCAAGATATCCAGTTTTGTGGTTTGGGGTCATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.30% 0.04% 0.00% A: 0.02%
All Indica  2759 95.70% 4.30% 0.00% 0.00% A: 0.04%
All Japonica  1512 86.70% 13.20% 0.13% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 94.80% 5.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 95.50% 4.40% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 95.00% 5.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 64.50% 35.30% 0.20% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126418162 G -> T LOC_Os01g46410.1 upstream_gene_variant ; 1980.0bp to feature; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> T LOC_Os01g46420.1 upstream_gene_variant ; 137.0bp to feature; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> T LOC_Os01g46430.1 upstream_gene_variant ; 2101.0bp to feature; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> T LOC_Os01g46410-LOC_Os01g46420 intergenic_region ; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> A LOC_Os01g46410.1 upstream_gene_variant ; 1980.0bp to feature; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> A LOC_Os01g46420.1 upstream_gene_variant ; 137.0bp to feature; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> A LOC_Os01g46430.1 upstream_gene_variant ; 2101.0bp to feature; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N
vg0126418162 G -> A LOC_Os01g46410-LOC_Os01g46420 intergenic_region ; MODIFIER silent_mutation Average:98.714; most accessible tissue: Zhenshan97 root, score: 99.771 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0126418162 G A -0.06 -0.08 -0.07 -0.04 -0.05 -0.05
vg0126418162 G T -0.04 -0.03 -0.04 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126418162 7.68E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 2.46E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 4.42E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 3.04E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 1.37E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 4.68E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 8.59E-06 8.59E-06 mr1208 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 5.21E-07 NA mr1264 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 2.40E-06 2.40E-06 mr1264 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 2.32E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 3.35E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 4.05E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 9.86E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 2.07E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 1.54E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 3.69E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 1.57E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 1.74E-06 4.89E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 2.69E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 2.88E-07 2.07E-19 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 3.01E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126418162 NA 1.62E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251