\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126378704:

Variant ID: vg0126378704 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26378704
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTCTAGAGTAGGCTAACTACTGTCACGCCCCGAACCAGCCCCGACCGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTAATCGATACCAGTCCCAG[A/G]
AAACAGTGCTGGTACCACAGGGAGACAGAATACCACAGCAACAGAGGTCTCTTTATTATAGAGTAGAGGTACAGTCATGTTGGGCTGCGGACAGATTCCG

Reverse complement sequence

CGGAATCTGTCCGCAGCCCAACATGACTGTACCTCTACTCTATAATAAAGAGACCTCTGTTGCTGTGGTATTCTGTCTCCCTGTGGTACCAGCACTGTTT[T/C]
CTGGGACTGGTATCGATTAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGGTCGGGGCTGGTTCGGGGCGTGACAGTAGTTAGCCTACTCTAGAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 21.90% 2.71% 0.51% NA
All Indica  2759 95.30% 0.50% 3.30% 0.87% NA
All Japonica  1512 32.80% 66.20% 0.99% 0.00% NA
Aus  269 94.80% 0.40% 4.83% 0.00% NA
Indica I  595 93.80% 1.00% 5.21% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 95.20% 0.20% 2.08% 2.52% NA
Indica Intermediate  786 94.40% 0.50% 4.96% 0.13% NA
Temperate Japonica  767 3.80% 94.90% 1.30% 0.00% NA
Tropical Japonica  504 78.60% 20.80% 0.60% 0.00% NA
Japonica Intermediate  241 29.50% 69.70% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 72.20% 21.10% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126378704 A -> G LOC_Os01g46350.1 upstream_gene_variant ; 4603.0bp to feature; MODIFIER silent_mutation Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 N N N N
vg0126378704 A -> G LOC_Os01g46360.1 downstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 N N N N
vg0126378704 A -> G LOC_Os01g46370.2 downstream_gene_variant ; 4891.0bp to feature; MODIFIER silent_mutation Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 N N N N
vg0126378704 A -> G LOC_Os01g46360-LOC_Os01g46370 intergenic_region ; MODIFIER silent_mutation Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 N N N N
vg0126378704 A -> DEL N N silent_mutation Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126378704 NA 1.33E-33 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0126378704 NA 1.02E-53 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0126378704 NA 7.87E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704 NA 6.41E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704 NA 1.67E-08 mr1403 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704 NA 7.98E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704 NA 1.70E-22 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704 NA 1.52E-22 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126378704 NA 2.61E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251