\
| Variant ID: vg0126378704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26378704 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTCTAGAGTAGGCTAACTACTGTCACGCCCCGAACCAGCCCCGACCGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTAATCGATACCAGTCCCAG[A/G]
AAACAGTGCTGGTACCACAGGGAGACAGAATACCACAGCAACAGAGGTCTCTTTATTATAGAGTAGAGGTACAGTCATGTTGGGCTGCGGACAGATTCCG
CGGAATCTGTCCGCAGCCCAACATGACTGTACCTCTACTCTATAATAAAGAGACCTCTGTTGCTGTGGTATTCTGTCTCCCTGTGGTACCAGCACTGTTT[T/C]
CTGGGACTGGTATCGATTAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGGTCGGGGCTGGTTCGGGGCGTGACAGTAGTTAGCCTACTCTAGAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 21.90% | 2.71% | 0.51% | NA |
| All Indica | 2759 | 95.30% | 0.50% | 3.30% | 0.87% | NA |
| All Japonica | 1512 | 32.80% | 66.20% | 0.99% | 0.00% | NA |
| Aus | 269 | 94.80% | 0.40% | 4.83% | 0.00% | NA |
| Indica I | 595 | 93.80% | 1.00% | 5.21% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.20% | 0.20% | 2.08% | 2.52% | NA |
| Indica Intermediate | 786 | 94.40% | 0.50% | 4.96% | 0.13% | NA |
| Temperate Japonica | 767 | 3.80% | 94.90% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 20.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.50% | 69.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 21.10% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126378704 | A -> G | LOC_Os01g46350.1 | upstream_gene_variant ; 4603.0bp to feature; MODIFIER | silent_mutation | Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 | N | N | N | N |
| vg0126378704 | A -> G | LOC_Os01g46360.1 | downstream_gene_variant ; 543.0bp to feature; MODIFIER | silent_mutation | Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 | N | N | N | N |
| vg0126378704 | A -> G | LOC_Os01g46370.2 | downstream_gene_variant ; 4891.0bp to feature; MODIFIER | silent_mutation | Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 | N | N | N | N |
| vg0126378704 | A -> G | LOC_Os01g46360-LOC_Os01g46370 | intergenic_region ; MODIFIER | silent_mutation | Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 | N | N | N | N |
| vg0126378704 | A -> DEL | N | N | silent_mutation | Average:64.023; most accessible tissue: Zhenshan97 flower, score: 86.488 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126378704 | NA | 1.33E-33 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0126378704 | NA | 1.02E-53 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0126378704 | NA | 7.87E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126378704 | NA | 6.41E-09 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126378704 | NA | 1.67E-08 | mr1403 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126378704 | NA | 7.98E-07 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126378704 | NA | 1.70E-22 | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126378704 | NA | 1.52E-22 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126378704 | NA | 2.61E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |