Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126364837:

Variant ID: vg0126364837 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26364837
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATCCGCTCGGCTCGGCTCGCCTTCACCATGGTGGCCGGCCGCGTCAAGGCGGCCATGGGCTTCCAGCGCAGCCCCAAGGTGTCCAAGTCGCCGGCTCA[C/T]
GTCGGGCGGACGCCGGAGACTCCTGGCCGGGGGTCATCGTCTGGCTCCCCGGCGCCGGGCGGCTCGGCGTCCAAGGCTGTCTCCTTCGCGCGGTCCTTAG

Reverse complement sequence

CTAAGGACCGCGCGAAGGAGACAGCCTTGGACGCCGAGCCGCCCGGCGCCGGGGAGCCAGACGATGACCCCCGGCCAGGAGTCTCCGGCGTCCGCCCGAC[G/A]
TGAGCCGGCGACTTGGACACCTTGGGGCTGCGCTGGAAGCCCATGGCCGCCTTGACGCGGCCGGCCACCATGGTGAAGGCGAGCCGAGCCGAGCGGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 11.70% 0.85% 0.00% NA
All Indica  2759 98.40% 1.50% 0.07% 0.00% NA
All Japonica  1512 85.80% 12.10% 2.12% 0.00% NA
Aus  269 5.90% 92.20% 1.86% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.60% 0.13% 0.00% NA
Temperate Japonica  767 97.70% 0.10% 2.22% 0.00% NA
Tropical Japonica  504 66.30% 32.30% 1.39% 0.00% NA
Japonica Intermediate  241 88.80% 7.90% 3.32% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126364837 C -> T LOC_Os01g46340.1 synonymous_variant ; p.His24His; LOW synonymous_codon Average:84.802; most accessible tissue: Zhenshan97 panicle, score: 96.452 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0126364837 C T -0.05 -0.04 -0.04 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126364837 NA 3.48E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 1.92E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 3.50E-07 1.14E-06 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 2.52E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 3.02E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 2.10E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 3.60E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 1.44E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 7.98E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 1.03E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 3.70E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 1.49E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126364837 NA 1.32E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251