\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126344348:

Variant ID: vg0126344348 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26344348
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAGATAGCTTTACTCTCTCTCTCATTTAATCTCTTTCAAATAGAAAAATATACTGACGTAAATCTTTTATAGAGAATTTATAGATAACTATTGTGGGA[G/T,A]
TCCTAACACTGCTAGCAGGCGCTACCGCGCTAGTAGCTCGCACGCTTTCAGACCAACGGGGCCCGAAGTCCCGACCCACGCTGCCAACAGCTGAGCCCGT

Reverse complement sequence

ACGGGCTCAGCTGTTGGCAGCGTGGGTCGGGACTTCGGGCCCCGTTGGTCTGAAAGCGTGCGAGCTACTAGCGCGGTAGCGCCTGCTAGCAGTGTTAGGA[C/A,T]
TCCCACAATAGTTATCTATAAATTCTCTATAAAAGATTTACGTCAGTATATTTTTCTATTTGAAAGAGATTAAATGAGAGAGAGAGTAAAGCTATCTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.00% 6.40% 30.11% 34.51% A: 0.02%
All Indica  2759 15.50% 0.70% 33.71% 50.09% A: 0.04%
All Japonica  1512 56.40% 17.90% 16.93% 8.80% NA
Aus  269 17.80% 0.00% 61.71% 20.45% NA
Indica I  595 14.10% 0.00% 36.81% 49.08% NA
Indica II  465 11.80% 1.70% 33.76% 52.69% NA
Indica III  913 19.60% 0.20% 31.98% 48.19% NA
Indica Intermediate  786 14.00% 1.00% 33.33% 51.53% A: 0.13%
Temperate Japonica  767 91.90% 0.10% 3.52% 4.43% NA
Tropical Japonica  504 8.30% 50.00% 30.36% 11.31% NA
Japonica Intermediate  241 44.00% 7.10% 31.54% 17.43% NA
VI/Aromatic  96 11.50% 0.00% 48.96% 39.58% NA
Intermediate  90 33.30% 14.40% 26.67% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126344348 G -> T LOC_Os01g46320.1 upstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:89.375; most accessible tissue: Zhenshan97 panicle, score: 96.801 N N N N
vg0126344348 G -> T LOC_Os01g46310-LOC_Os01g46320 intergenic_region ; MODIFIER silent_mutation Average:89.375; most accessible tissue: Zhenshan97 panicle, score: 96.801 N N N N
vg0126344348 G -> A LOC_Os01g46320.1 upstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:89.375; most accessible tissue: Zhenshan97 panicle, score: 96.801 N N N N
vg0126344348 G -> A LOC_Os01g46310-LOC_Os01g46320 intergenic_region ; MODIFIER silent_mutation Average:89.375; most accessible tissue: Zhenshan97 panicle, score: 96.801 N N N N
vg0126344348 G -> DEL N N silent_mutation Average:89.375; most accessible tissue: Zhenshan97 panicle, score: 96.801 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0126344348 G A -0.05 -0.01 -0.01 -0.08 -0.05 -0.05
vg0126344348 G T -0.05 -0.05 -0.05 -0.06 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126344348 NA 6.99E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 5.48E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 2.20E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 1.37E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 9.84E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 2.69E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 6.29E-09 4.00E-18 mr1871 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 1.24E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 1.11E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 1.09E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 1.25E-06 1.54E-20 mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 5.58E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 5.97E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 4.69E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 3.03E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 1.69E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 2.51E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 2.15E-06 1.07E-17 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 NA 1.95E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126344348 1.66E-07 2.40E-23 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251