\
| Variant ID: vg0126148298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26148298 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGCTTCAAAAGGTTTTAAATTGTATCAAATGGATGTAAAAAGTACTTTTCTAAATGGTTTTATACAGGAGGAAGTTTATGTCAAACAACCACCAGGTTTT[A/G]
AAAATCCTGATTTTCCCAACCATGTTTTTAAATTGTCTAAAGCTTTGTATGGTTTGAAACAAGCTCCTAGGGCATGGTATGATAGGCTTAAGAACTTTTT
AAAAAGTTCTTAAGCCTATCATACCATGCCCTAGGAGCTTGTTTCAAACCATACAAAGCTTTAGACAATTTAAAAACATGGTTGGGAAAATCAGGATTTT[T/C]
AAAACCTGGTGGTTGTTTGACATAAACTTCCTCCTGTATAAAACCATTTAGAAAAGTACTTTTTACATCCATTTGATACAATTTAAAACCTTTTGAAGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 16.80% | 4.04% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 1.50% | 3.52% | 0.00% | NA |
| All Japonica | 1512 | 64.50% | 34.10% | 1.39% | 0.00% | NA |
| Aus | 269 | 17.50% | 57.60% | 24.91% | 0.00% | NA |
| Indica I | 595 | 96.00% | 0.00% | 4.03% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 94.90% | 1.80% | 3.40% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 2.40% | 4.96% | 0.00% | NA |
| Temperate Japonica | 767 | 95.00% | 3.40% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 28.40% | 70.80% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.70% | 55.20% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 63.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126148298 | A -> G | LOC_Os01g46000.1 | missense_variant ; p.Lys1190Glu; MODERATE | nonsynonymous_codon ; K1190E | Average:15.736; most accessible tissue: Minghui63 flower, score: 23.1 | benign |
-0.781 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126148298 | NA | 5.99E-06 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 1.76E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 6.46E-11 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 7.89E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 1.65E-16 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 1.54E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 9.48E-10 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 6.89E-16 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 2.77E-19 | mr1552_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 8.71E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 1.04E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 9.72E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 3.43E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 2.83E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 3.85E-12 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126148298 | NA | 1.29E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |