\
| Variant ID: vg0125967068 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 25967068 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, C: 0.28, others allele: 0.00, population size: 168. )
AGGTTTTGGCTGGACGGTCGAGATGAAGCCCCAATGACGGTTGAAGCTATAAAAGGACTTCACCTTCTCACTTCACTCACACACCTCAAGCAAGAGCTCT[A/C]
TCATTCCTCTCAAGTTTAGTTTAGTAGTATCTAGCTGGTGGAATAGAATTAGAATAGGAATCAGGAGTCCGGAAGTCTTCGGAAGAGTTCGGGTATGGCT
AGCCATACCCGAACTCTTCCGAAGACTTCCGGACTCCTGATTCCTATTCTAATTCTATTCCACCAGCTAGATACTACTAAACTAAACTTGAGAGGAATGA[T/G]
AGAGCTCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAAGTCCTTTTATAGCTTCAACCGTCATTGGGGCTTCATCTCGACCGTCCAGCCAAAACCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 7.40% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 87.50% | 11.90% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 60.20% | 39.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.90% | 3.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 7.10% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0125967068 | A -> C | LOC_Os01g45740.1 | upstream_gene_variant ; 3092.0bp to feature; MODIFIER | silent_mutation | Average:37.015; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| vg0125967068 | A -> C | LOC_Os01g45730-LOC_Os01g45740 | intergenic_region ; MODIFIER | silent_mutation | Average:37.015; most accessible tissue: Minghui63 flag leaf, score: 59.244 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0125967068 | NA | 3.31E-07 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 5.70E-07 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 3.12E-07 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 7.81E-06 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 7.62E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 9.16E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 3.31E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 6.08E-08 | mr1474_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 9.96E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 7.33E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 9.39E-07 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | 8.27E-06 | 8.27E-06 | mr1753_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 5.18E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 8.15E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 2.05E-08 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125967068 | NA | 2.95E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |