\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125967068:

Variant ID: vg0125967068 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25967068
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, C: 0.28, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTTTTGGCTGGACGGTCGAGATGAAGCCCCAATGACGGTTGAAGCTATAAAAGGACTTCACCTTCTCACTTCACTCACACACCTCAAGCAAGAGCTCT[A/C]
TCATTCCTCTCAAGTTTAGTTTAGTAGTATCTAGCTGGTGGAATAGAATTAGAATAGGAATCAGGAGTCCGGAAGTCTTCGGAAGAGTTCGGGTATGGCT

Reverse complement sequence

AGCCATACCCGAACTCTTCCGAAGACTTCCGGACTCCTGATTCCTATTCTAATTCTATTCCACCAGCTAGATACTACTAAACTAAACTTGAGAGGAATGA[T/G]
AGAGCTCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAAGTCCTTTTATAGCTTCAACCGTCATTGGGGCTTCATCTCGACCGTCCAGCCAAAACCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.40% 0.38% 0.00% NA
All Indica  2759 87.50% 11.90% 0.65% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 60.20% 39.30% 0.50% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 95.90% 3.80% 0.22% 0.00% NA
Indica Intermediate  786 91.20% 7.10% 1.65% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125967068 A -> C LOC_Os01g45740.1 upstream_gene_variant ; 3092.0bp to feature; MODIFIER silent_mutation Average:37.015; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N
vg0125967068 A -> C LOC_Os01g45730-LOC_Os01g45740 intergenic_region ; MODIFIER silent_mutation Average:37.015; most accessible tissue: Minghui63 flag leaf, score: 59.244 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125967068 NA 3.31E-07 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 5.70E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 3.12E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 7.81E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 7.62E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 9.16E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 3.31E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 6.08E-08 mr1474_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 9.96E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 7.33E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 9.39E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 8.27E-06 8.27E-06 mr1753_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 5.18E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 8.15E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 2.05E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125967068 NA 2.95E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251