\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125786178:

Variant ID: vg0125786178 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25786178
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTGTGTTGAGTTCAAAGTGACAACCAAACAAGCCCCTTTTTTTAAGAATACAGTACAAACACAAGAGTTCACAACACGCACACACTCACATCTTACCC[C/G]
TATTAAGAAGACCCCTATTCACCACAGACGCCTCGCTGTAAACATGTACACCATCTACCATCGAAAGAGTAAATAACCGTAAATTCAAGTACCGTGTTAA

Reverse complement sequence

TTAACACGGTACTTGAATTTACGGTTATTTACTCTTTCGATGGTAGATGGTGTACATGTTTACAGCGAGGCGTCTGTGGTGAATAGGGGTCTTCTTAATA[G/C]
GGGTAAGATGTGAGTGTGTGCGTGTTGTGAACTCTTGTGTTTGTACTGTATTCTTAAAAAAAGGGGCTTGTTTGGTTGTCACTTTGAACTCAACACAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 12.10% 1.99% 0.00% NA
All Indica  2759 96.10% 2.60% 1.34% 0.00% NA
All Japonica  1512 81.60% 15.70% 2.65% 0.00% NA
Aus  269 6.30% 89.20% 4.46% 0.00% NA
Indica I  595 98.70% 0.00% 1.34% 0.00% NA
Indica II  465 95.70% 2.80% 1.51% 0.00% NA
Indica III  913 96.80% 2.60% 0.55% 0.00% NA
Indica Intermediate  786 93.50% 4.30% 2.16% 0.00% NA
Temperate Japonica  767 97.90% 0.70% 1.43% 0.00% NA
Tropical Japonica  504 52.40% 43.50% 4.17% 0.00% NA
Japonica Intermediate  241 90.90% 5.80% 3.32% 0.00% NA
VI/Aromatic  96 82.30% 14.60% 3.12% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125786178 C -> G LOC_Os01g45439.1 upstream_gene_variant ; 4244.0bp to feature; MODIFIER silent_mutation Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0125786178 C -> G LOC_Os01g45450.1 upstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0125786178 C -> G LOC_Os01g45439.2 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0125786178 C -> G LOC_Os01g45439-LOC_Os01g45450 intergenic_region ; MODIFIER silent_mutation Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125786178 NA 5.96E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 2.95E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 5.18E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 5.79E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.78E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 2.05E-18 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 3.01E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 4.26E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 6.26E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 2.86E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.52E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 3.63E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 2.36E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.70E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 2.82E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.11E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.32E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.54E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 3.28E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 8.82E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.14E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 4.04E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 9.17E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.04E-12 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 2.74E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 2.48E-08 2.70E-14 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 1.33E-10 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 5.01E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178 NA 5.43E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251