Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125786178:

Variant ID: vg0125786178 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25786178
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTGTGTTGAGTTCAAAGTGACAACCAAACAAGCCCCTTTTTTTAAGAATACAGTACAAACACAAGAGTTCACAACACGCACACACTCACATCTTACCC[C/G]
TATTAAGAAGACCCCTATTCACCACAGACGCCTCGCTGTAAACATGTACACCATCTACCATCGAAAGAGTAAATAACCGTAAATTCAAGTACCGTGTTAA

Reverse complement sequence

TTAACACGGTACTTGAATTTACGGTTATTTACTCTTTCGATGGTAGATGGTGTACATGTTTACAGCGAGGCGTCTGTGGTGAATAGGGGTCTTCTTAATA[G/C]
GGGTAAGATGTGAGTGTGTGCGTGTTGTGAACTCTTGTGTTTGTACTGTATTCTTAAAAAAAGGGGCTTGTTTGGTTGTCACTTTGAACTCAACACAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.90%	12.10%	1.99%	0.00%	NA
All Indica	2759	96.10%	2.60%	1.34%	0.00%	NA
All Japonica	1512	81.60%	15.70%	2.65%	0.00%	NA
Aus	269	6.30%	89.20%	4.46%	0.00%	NA
Indica I	595	98.70%	0.00%	1.34%	0.00%	NA
Indica II	465	95.70%	2.80%	1.51%	0.00%	NA
Indica III	913	96.80%	2.60%	0.55%	0.00%	NA
Indica Intermediate	786	93.50%	4.30%	2.16%	0.00%	NA
Temperate Japonica	767	97.90%	0.70%	1.43%	0.00%	NA
Tropical Japonica	504	52.40%	43.50%	4.17%	0.00%	NA
Japonica Intermediate	241	90.90%	5.80%	3.32%	0.00%	NA
VI/Aromatic	96	82.30%	14.60%	3.12%	0.00%	NA
Intermediate	90	85.60%	12.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125786178	C -> G	LOC_Os01g45439.1	upstream_gene_variant ; 4244.0bp to feature; MODIFIER	silent_mutation	Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0125786178	C -> G	LOC_Os01g45450.1	upstream_gene_variant ; 2524.0bp to feature; MODIFIER	silent_mutation	Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0125786178	C -> G	LOC_Os01g45439.2	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0125786178	C -> G	LOC_Os01g45439-LOC_Os01g45450	intergenic_region ; MODIFIER	silent_mutation	Average:60.593; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125786178	NA	5.96E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	2.95E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	5.18E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	5.79E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.78E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	2.05E-18	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	3.01E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	4.26E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	6.26E-10	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	2.86E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.52E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	3.63E-08	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	2.36E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.70E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	2.82E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.11E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.32E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.54E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	3.28E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	8.82E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.14E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	4.04E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	9.17E-11	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.04E-12	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	2.74E-08	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	2.48E-08	2.70E-14	mr1800_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	1.33E-10	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	5.01E-10	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125786178	NA	5.43E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251