Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125649810:

Variant ID: vg0125649810 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 25649810
Reference Allele: T	Alternative Allele: TA,A,TTA
Primary Allele: TA	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCATCTTTCAATATTCTTTAATTTTTAATTTCGAATTTCAGCTACTTCTAAATTGTATTCCTATATTGACCTTAAACTCTTCTTCCCATGTTTTTTTT[T/TA,A,TTA]
ATTTCGAATTTTAGTTATTTGTAAATTATATTTTTATACAGACTCTAAACTCTACTTTTAATTTTATTATGTTTATTCCAAATTTTAGTTAGTTTTAAAT

Reverse complement sequence

ATTTAAAACTAACTAAAATTTGGAATAAACATAATAAAATTAAAAGTAGAGTTTAGAGTCTGTATAAAAATATAATTTACAAATAACTAAAATTCGAAAT[A/TA,T,TAA]
AAAAAAAACATGGGAAGAAGAGTTTAAGGTCAATATAGGAATACAATTTAGAAGTAGCTGAAATTCGAAATTAAAAATTAAAGAATATTGAAAGATGAGT

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.40%	23.30%	21.79%	9.99%	A: 19.53%
All Indica	2759	42.40%	12.70%	23.67%	13.70%	A: 7.50%
All Japonica	1512	0.90%	46.30%	21.23%	5.36%	A: 26.19%
Aus	269	0.70%	1.10%	7.06%	0.37%	A: 90.71%
Indica I	595	27.20%	2.20%	46.22%	13.78%	A: 10.59%
Indica II	465	39.60%	5.40%	22.80%	29.46%	A: 2.80%
Indica III	913	51.90%	25.70%	9.75%	4.16%	A: 8.43%
Indica Intermediate	786	44.50%	9.90%	23.28%	15.39%	A: 6.87%
Temperate Japonica	767	0.30%	74.80%	7.82%	8.87%	A: 8.21%
Tropical Japonica	504	1.00%	10.50%	40.28%	0.79%	A: 47.42%
Japonica Intermediate	241	2.90%	30.30%	24.07%	3.73%	A: 39.00%
VI/Aromatic	96	0.00%	31.20%	10.42%	1.04%	A: 57.29%
Intermediate	90	14.40%	20.00%	30.00%	12.22%	A: 23.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125649810	T -> TA	LOC_Os01g45200.1	upstream_gene_variant ; 2587.0bp to feature; MODIFIER	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> TA	LOC_Os01g45210.1	upstream_gene_variant ; 4127.0bp to feature; MODIFIER	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> TA	LOC_Os01g45200-LOC_Os01g45210	intergenic_region ; MODIFIER	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> A	LOC_Os01g45200.1	upstream_gene_variant ; 2586.0bp to feature; MODIFIER	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> A	LOC_Os01g45210.1	upstream_gene_variant ; 4128.0bp to feature; MODIFIER	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> A	LOC_Os01g45200-LOC_Os01g45210	intergenic_region ; MODIFIER	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> TTA	LOC_Os01g45200.1	upstream_gene_variant ; 2587.0bp to feature; MODIFIER	N	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> TTA	LOC_Os01g45210.1	upstream_gene_variant ; 4127.0bp to feature; MODIFIER	N	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> TTA	LOC_Os01g45200-LOC_Os01g45210	intergenic_region ; MODIFIER	N	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0125649810	T -> DEL	N	N	silent_mutation	Average:21.15; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125649810	NA	1.43E-27	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0125649810	NA	1.76E-10	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	4.76E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	3.52E-11	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	5.48E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	3.76E-07	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	2.63E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	8.03E-18	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.50E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.06E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.76E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	4.13E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	4.77E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	2.71E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.81E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	3.03E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	5.15E-07	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.42E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.98E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	7.67E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	9.70E-06	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	2.64E-25	mr1794_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	2.04E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	4.74E-07	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	8.31E-08	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	6.09E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	4.72E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	1.82E-06	mr1923_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	6.09E-08	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125649810	NA	2.33E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251