\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125634078:

Variant ID: vg0125634078 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25634078
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAATGTGTCATATTAGTGTGAATCGACAGATGTTGCAAATTATTGTGGACATGTAGATTTTAATGCAACAACTCAAAGCGTAGTGAAAGATCTTACC[A/G]
GTGAATAGCAGCTAGGACGGTCGTCGGAAACGGTACTGGAAAGGGCTGACGGAAGCCGAACTGCCGCATCACGCGGAAAGGGGCGTGAGGCTCAACGCAG

Reverse complement sequence

CTGCGTTGAGCCTCACGCCCCTTTCCGCGTGATGCGGCAGTTCGGCTTCCGTCAGCCCTTTCCAGTACCGTTTCCGACGACCGTCCTAGCTGCTATTCAC[T/C]
GGTAAGATCTTTCACTACGCTTTGAGTTGTTGCATTAAAATCTACATGTCCACAATAATTTGCAACATCTGTCGATTCACACTAATATGACACATTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 27.10% 2.54% 0.00% NA
All Indica  2759 81.90% 13.80% 4.24% 0.00% NA
All Japonica  1512 44.80% 55.20% 0.00% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 79.20% 3.50% 17.31% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 73.30% 26.60% 0.11% 0.00% NA
Indica Intermediate  786 87.30% 11.10% 1.65% 0.00% NA
Temperate Japonica  767 12.40% 87.60% 0.00% 0.00% NA
Tropical Japonica  504 84.10% 15.90% 0.00% 0.00% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125634078 A -> G LOC_Os01g45174.1 missense_variant&splice_region_variant ; p.Cys506Arg; MODERATE nonsynonymous_codon ; C506R Average:29.471; most accessible tissue: Minghui63 panicle, score: 46.754 unknown unknown TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125634078 NA 2.19E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 3.91E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 2.90E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 9.39E-06 mr1418 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 7.13E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 5.49E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 7.98E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 8.61E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 6.83E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 3.15E-07 3.15E-07 mr1840 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 1.32E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 2.27E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 1.81E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 3.55E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 5.29E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 2.60E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 3.37E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 2.70E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 2.55E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125634078 NA 4.77E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251