\
| Variant ID: vg0125460306 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 25460306 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGGATACAATATTTTCCTTTAGAGGGTGGGATATTATTTCCCTATTTCATTTTATCGACGTTTGATGTCTCGACTACAGTATTTGCATGGCATGGGGAT[C/T]
GTTGGTACTAGGGTATACGCAAGACTGAGGTAAAAGAGATGGAGACGAGGATTTTTATACAGGTTCGGGCCCCTGAATTGTCAGGTAATAACCCTACATC
GATGTAGGGTTATTACCTGACAATTCAGGGGCCCGAACCTGTATAAAAATCCTCGTCTCCATCTCTTTTACCTCAGTCTTGCGTATACCCTAGTACCAAC[G/A]
ATCCCCATGCCATGCAAATACTGTAGTCGAGACATCAAACGTCGATAAAATGAAATAGGGAAATAATATCCCACCCTCTAAAGGAAAATATTGTATCCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 9.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0125460306 | C -> T | LOC_Os01g44380.1 | upstream_gene_variant ; 762.0bp to feature; MODIFIER | silent_mutation | Average:39.224; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0125460306 | C -> T | LOC_Os01g44390.2 | upstream_gene_variant ; 1697.0bp to feature; MODIFIER | silent_mutation | Average:39.224; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0125460306 | C -> T | LOC_Os01g44390.1 | upstream_gene_variant ; 1685.0bp to feature; MODIFIER | silent_mutation | Average:39.224; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0125460306 | C -> T | LOC_Os01g44370.1 | downstream_gene_variant ; 2444.0bp to feature; MODIFIER | silent_mutation | Average:39.224; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0125460306 | C -> T | LOC_Os01g44380-LOC_Os01g44390 | intergenic_region ; MODIFIER | silent_mutation | Average:39.224; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0125460306 | NA | 1.07E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125460306 | NA | 8.63E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125460306 | 8.98E-07 | 8.98E-07 | mr1832 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |