Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125460260:

Variant ID: vg0125460260 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25460260
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.05, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAATGGCTAGCTAGGATTAAATGAGTTGTGAAGAATGGATGGCTAGGATACAATATTTTCCTTTAGAGGGTGGGATATTATTTCCCTATTTCATTTT[A/G,T]
TCGACGTTTGATGTCTCGACTACAGTATTTGCATGGCATGGGGATCGTTGGTACTAGGGTATACGCAAGACTGAGGTAAAAGAGATGGAGACGAGGATTT

Reverse complement sequence

AAATCCTCGTCTCCATCTCTTTTACCTCAGTCTTGCGTATACCCTAGTACCAACGATCCCCATGCCATGCAAATACTGTAGTCGAGACATCAAACGTCGA[T/C,A]
AAAATGAAATAGGGAAATAATATCCCACCCTCTAAAGGAAAATATTGTATCCTAGCCATCCATTCTTCACAACTCATTTAATCCTAGCTAGCCATTCATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	32.00%	0.08%	0.11%	T: 0.02%
All Indica	2759	95.30%	4.50%	0.11%	0.14%	NA
All Japonica	1512	31.90%	68.00%	0.00%	0.07%	NA
Aus	269	7.80%	92.20%	0.00%	0.00%	NA
Indica I	595	99.00%	0.50%	0.34%	0.17%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	93.30%	6.50%	0.00%	0.22%	NA
Indica Intermediate	786	94.30%	5.50%	0.13%	0.13%	NA
Temperate Japonica	767	25.30%	74.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.10%	65.70%	0.00%	0.20%	NA
Japonica Intermediate	241	48.50%	51.50%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	58.90%	38.90%	1.11%	0.00%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125460260	A -> G	LOC_Os01g44380.1	upstream_gene_variant ; 716.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> G	LOC_Os01g44390.2	upstream_gene_variant ; 1743.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> G	LOC_Os01g44390.1	upstream_gene_variant ; 1731.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> G	LOC_Os01g44370.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> G	LOC_Os01g44380-LOC_Os01g44390	intergenic_region ; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> T	LOC_Os01g44380.1	upstream_gene_variant ; 716.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> T	LOC_Os01g44390.2	upstream_gene_variant ; 1743.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> T	LOC_Os01g44390.1	upstream_gene_variant ; 1731.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> T	LOC_Os01g44370.1	downstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> T	LOC_Os01g44380-LOC_Os01g44390	intergenic_region ; MODIFIER	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0125460260	A -> DEL	N	N	silent_mutation	Average:38.658; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125460260	NA	6.57E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	2.35E-06	mr1219	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	4.23E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	1.05E-09	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	3.20E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	6.18E-09	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	6.16E-18	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	2.07E-06	1.36E-07	mr1219_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125460260	NA	2.78E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251