\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125172210:

Variant ID: vg0125172210 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25172210
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCTCCGGTGTACTTCGAGATAGTCGCCGAGGTTCCTCCAGATGCAGAGCAAGGCAAGTCATGCTTGTCACTTGAACATGTTGATCCTATATTGCAAAT[A/G]
CTCTATTGTTTTTCTTCAAATACTGCATCATTTTATAATGTTACTATGGGATGTTTACCTATTGTTACAGCCATGCTATTTTGGTACCCTGCTCCTTTGT

Reverse complement sequence

ACAAAGGAGCAGGGTACCAAAATAGCATGGCTGTAACAATAGGTAAACATCCCATAGTAACATTATAAAATGATGCAGTATTTGAAGAAAAACAATAGAG[T/C]
ATTTGCAATATAGGATCAACATGTTCAAGTGACAAGCATGACTTGCCTTGCTCTGCATCTGGAGGAACCTCGGCGACTATCTCGAAGTACACCGGAGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 26.60% 0.30% 3.72% NA
All Indica  2759 98.20% 1.60% 0.14% 0.00% NA
All Japonica  1512 16.30% 72.20% 0.33% 11.18% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 96.80% 3.10% 0.11% 0.00% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 98.20% 0.00% 0.91% NA
Tropical Japonica  504 39.30% 35.50% 0.99% 24.21% NA
Japonica Intermediate  241 17.40% 66.00% 0.00% 16.60% NA
VI/Aromatic  96 9.40% 85.40% 0.00% 5.21% NA
Intermediate  90 53.30% 38.90% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125172210 A -> G LOC_Os01g43930.1 upstream_gene_variant ; 1485.0bp to feature; MODIFIER silent_mutation Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0125172210 A -> G LOC_Os01g43920.1 downstream_gene_variant ; 1771.0bp to feature; MODIFIER silent_mutation Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0125172210 A -> G LOC_Os01g43920-LOC_Os01g43930 intergenic_region ; MODIFIER silent_mutation Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0125172210 A -> DEL N N silent_mutation Average:13.71; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125172210 NA 4.31E-08 mr1946 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125172210 1.32E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125172210 6.72E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251