\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125134011:

Variant ID: vg0125134011 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25134011
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGATTGCACTCGATAGAACAGCGGTGGGGTCAACACTTCTAAGTCATCAAAATGGTAAAGTCCGTATTTATACTATTCTTGATTTTGTTTGCTCTGG[C/T]
TGATTTTGAAGAATTTCTGCTCAGCATACACCTGAACCTGCCGCACTGCAAAAGCTGTTTTTAATTCTATGCTTTTAGCACCAGTGACTCTCCAAGTGCA

Reverse complement sequence

TGCACTTGGAGAGTCACTGGTGCTAAAAGCATAGAATTAAAAACAGCTTTTGCAGTGCGGCAGGTTCAGGTGTATGCTGAGCAGAAATTCTTCAAAATCA[G/A]
CCAGAGCAAACAAAATCAAGAATAGTATAAATACGGACTTTACCATTTTGATGACTTAGAAGTGTTGACCCCACCGCTGTTCTATCGAGTGCAATCTCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 34.90% 0.02% 0.00% NA
All Indica  2759 94.30% 5.70% 0.00% 0.00% NA
All Japonica  1512 9.90% 90.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 84.70% 15.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 22.60% 77.40% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125134011 C -> T LOC_Os01g43860.1 downstream_gene_variant ; 4044.0bp to feature; MODIFIER silent_mutation Average:81.344; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0125134011 C -> T LOC_Os01g43870.1 intron_variant ; MODIFIER silent_mutation Average:81.344; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0125134011 C -> T LOC_Os01g43870.3 intron_variant ; MODIFIER silent_mutation Average:81.344; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0125134011 C -> T LOC_Os01g43870.2 intron_variant ; MODIFIER silent_mutation Average:81.344; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0125134011 C -> T LOC_Os01g43870.6 intron_variant ; MODIFIER silent_mutation Average:81.344; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N
vg0125134011 C -> T LOC_Os01g43870.4 intron_variant ; MODIFIER silent_mutation Average:81.344; most accessible tissue: Minghui63 flag leaf, score: 93.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0125134011 C T -0.02 -0.01 0.0 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125134011 2.74E-07 5.30E-09 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125134011 NA 2.64E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125134011 NA 1.12E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125134011 NA 2.78E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125134011 NA 8.98E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125134011 NA 4.33E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125134011 NA 1.93E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251