\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125113438:

Variant ID: vg0125113438 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25113438
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTGCTCGGAAAAGACTTTTATTTATACTTATGCATCTAGACAAGTTTTTTTTATAAGTTTATAGCTAAAAATAAAGCTTTTACGGGGAGAGCTAGTA[G/A]
CTCGTTAATGAGTCCTTTAGAAAAAAAGAAAAGGCTAGTATCTCGTTAAGATAAGGGCTTCCCCACCAGGCTGCCGAATCATCATTATGCACCCATATCG

Reverse complement sequence

CGATATGGGTGCATAATGATGATTCGGCAGCCTGGTGGGGAAGCCCTTATCTTAACGAGATACTAGCCTTTTCTTTTTTTCTAAAGGACTCATTAACGAG[C/T]
TACTAGCTCTCCCCGTAAAAGCTTTATTTTTAGCTATAAACTTATAAAAAAAACTTGTCTAGATGCATAAGTATAAATAAAAGTCTTTTCCGAGCAAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.70% 0.08% 0.00% NA
All Indica  2759 37.90% 62.00% 0.11% 0.00% NA
All Japonica  1512 97.20% 2.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 52.60% 47.40% 0.00% 0.00% NA
Indica II  465 13.80% 86.20% 0.00% 0.00% NA
Indica III  913 45.80% 54.20% 0.00% 0.00% NA
Indica Intermediate  786 31.80% 67.80% 0.38% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 5.60% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125113438 G -> A LOC_Os01g43820.1 upstream_gene_variant ; 2833.0bp to feature; MODIFIER silent_mutation Average:67.355; most accessible tissue: Callus, score: 96.399 N N N N
vg0125113438 G -> A LOC_Os01g43830.1 upstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:67.355; most accessible tissue: Callus, score: 96.399 N N N N
vg0125113438 G -> A LOC_Os01g43844.1 upstream_gene_variant ; 643.0bp to feature; MODIFIER silent_mutation Average:67.355; most accessible tissue: Callus, score: 96.399 N N N N
vg0125113438 G -> A LOC_Os01g43830-LOC_Os01g43844 intergenic_region ; MODIFIER silent_mutation Average:67.355; most accessible tissue: Callus, score: 96.399 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125113438 NA 7.43E-07 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 1.55E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 1.52E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 3.27E-06 mr1229 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 7.78E-06 mr1418 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 7.17E-06 7.17E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 8.97E-09 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 3.16E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 8.31E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 6.07E-07 6.07E-07 mr1748 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 4.56E-06 mr1763 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 3.34E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 8.73E-07 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 2.56E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 3.26E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 1.84E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438 NA 6.72E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251