Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125113438:

Variant ID: vg0125113438 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25113438
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTGCTCGGAAAAGACTTTTATTTATACTTATGCATCTAGACAAGTTTTTTTTATAAGTTTATAGCTAAAAATAAAGCTTTTACGGGGAGAGCTAGTA[G/A]
CTCGTTAATGAGTCCTTTAGAAAAAAAGAAAAGGCTAGTATCTCGTTAAGATAAGGGCTTCCCCACCAGGCTGCCGAATCATCATTATGCACCCATATCG

Reverse complement sequence

CGATATGGGTGCATAATGATGATTCGGCAGCCTGGTGGGGAAGCCCTTATCTTAACGAGATACTAGCCTTTTCTTTTTTTCTAAAGGACTCATTAACGAG[C/T]
TACTAGCTCTCCCCGTAAAAGCTTTATTTTTAGCTATAAACTTATAAAAAAAACTTGTCTAGATGCATAAGTATAAATAAAAGTCTTTTCCGAGCAAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.70%	0.08%	0.00%	NA
All Indica	2759	37.90%	62.00%	0.11%	0.00%	NA
All Japonica	1512	97.20%	2.70%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	52.60%	47.40%	0.00%	0.00%	NA
Indica II	465	13.80%	86.20%	0.00%	0.00%	NA
Indica III	913	45.80%	54.20%	0.00%	0.00%	NA
Indica Intermediate	786	31.80%	67.80%	0.38%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.20%	5.60%	0.20%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125113438	G -> A	LOC_Os01g43820.1	upstream_gene_variant ; 2833.0bp to feature; MODIFIER	silent_mutation	Average:67.355; most accessible tissue: Callus, score: 96.399	N	N	N	N
vg0125113438	G -> A	LOC_Os01g43830.1	upstream_gene_variant ; 1390.0bp to feature; MODIFIER	silent_mutation	Average:67.355; most accessible tissue: Callus, score: 96.399	N	N	N	N
vg0125113438	G -> A	LOC_Os01g43844.1	upstream_gene_variant ; 643.0bp to feature; MODIFIER	silent_mutation	Average:67.355; most accessible tissue: Callus, score: 96.399	N	N	N	N
vg0125113438	G -> A	LOC_Os01g43830-LOC_Os01g43844	intergenic_region ; MODIFIER	silent_mutation	Average:67.355; most accessible tissue: Callus, score: 96.399	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125113438	NA	7.43E-07	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	1.55E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	1.52E-10	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	3.27E-06	mr1229	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	7.78E-06	mr1418	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	7.17E-06	7.17E-06	mr1545	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	8.97E-09	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	3.16E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	8.31E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	6.07E-07	6.07E-07	mr1748	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	4.56E-06	mr1763	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	3.34E-06	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	8.73E-07	mr1838	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	2.56E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	3.26E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	1.84E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125113438	NA	6.72E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251