\
| Variant ID: vg0125082187 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 25082187 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 122. )
GGCTTAACTATGCCACTGCCGTCCTAGCCGTTAGCTCAACCACAAACCAAATTAACCCCTCCGCCGCCGCTCGCCGTCGCCGGAGAACCCTAGCTCCCTC[C/T]
CCTCCTCGGCCGCAACCACTTTCCCCCTCCATCGCCCGATTTGGGGAATGGCCGGAGGTAGAAGAAGAGAAGAGAGAGAGAGAGAGACTGACAGGTGGGA
TCCCACCTGTCAGTCTCTCTCTCTCTCTCTTCTCTTCTTCTACCTCCGGCCATTCCCCAAATCGGGCGATGGAGGGGGAAAGTGGTTGCGGCCGAGGAGG[G/A]
GAGGGAGCTAGGGTTCTCCGGCGACGGCGAGCGGCGGCGGAGGGGTTAATTTGGTTTGTGGTTGAGCTAACGGCTAGGACGGCAGTGGCATAGTTAAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 37.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 38.10% | 61.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 52.60% | 47.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 13.80% | 86.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 32.40% | 67.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0125082187 | C -> T | LOC_Os01g43774.1 | downstream_gene_variant ; 3638.0bp to feature; MODIFIER | silent_mutation | Average:47.044; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0125082187 | C -> T | LOC_Os01g43774-LOC_Os01g43790 | intergenic_region ; MODIFIER | silent_mutation | Average:47.044; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0125082187 | NA | 3.67E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 3.66E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 4.45E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 1.57E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 7.48E-11 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 9.17E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 1.09E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 2.71E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 1.46E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | 2.98E-06 | 3.00E-07 | mr1418 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | 8.67E-06 | 8.66E-06 | mr1420 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 4.79E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 8.74E-08 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | 8.55E-07 | 8.55E-07 | mr1748 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 8.45E-07 | mr1811 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | 2.60E-06 | 2.60E-06 | mr1811 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 4.88E-07 | mr1838 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 6.33E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 7.73E-06 | mr1856 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 1.51E-06 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0125082187 | NA | 6.91E-10 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |