Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125082187:

Variant ID: vg0125082187 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25082187
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GGCTTAACTATGCCACTGCCGTCCTAGCCGTTAGCTCAACCACAAACCAAATTAACCCCTCCGCCGCCGCTCGCCGTCGCCGGAGAACCCTAGCTCCCTC[C/T]
CCTCCTCGGCCGCAACCACTTTCCCCCTCCATCGCCCGATTTGGGGAATGGCCGGAGGTAGAAGAAGAGAAGAGAGAGAGAGAGAGACTGACAGGTGGGA

Reverse complement sequence

TCCCACCTGTCAGTCTCTCTCTCTCTCTCTTCTCTTCTTCTACCTCCGGCCATTCCCCAAATCGGGCGATGGAGGGGGAAAGTGGTTGCGGCCGAGGAGG[G/A]
GAGGGAGCTAGGGTTCTCCGGCGACGGCGAGCGGCGGCGGAGGGGTTAATTTGGTTTGTGGTTGAGCTAACGGCTAGGACGGCAGTGGCATAGTTAAGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.60%	0.04%	0.00%	NA
All Indica	2759	38.10%	61.90%	0.07%	0.00%	NA
All Japonica	1512	97.30%	2.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	52.60%	47.20%	0.17%	0.00%	NA
Indica II	465	13.80%	86.20%	0.00%	0.00%	NA
Indica III	913	45.80%	54.20%	0.00%	0.00%	NA
Indica Intermediate	786	32.40%	67.40%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.40%	5.60%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125082187	C -> T	LOC_Os01g43774.1	downstream_gene_variant ; 3638.0bp to feature; MODIFIER	silent_mutation	Average:47.044; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0125082187	C -> T	LOC_Os01g43774-LOC_Os01g43790	intergenic_region ; MODIFIER	silent_mutation	Average:47.044; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125082187	NA	3.67E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	3.66E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	4.45E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	1.57E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	7.48E-11	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	9.17E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	1.09E-10	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	2.71E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	1.46E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	2.98E-06	3.00E-07	mr1418	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	8.67E-06	8.66E-06	mr1420	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	4.79E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	8.74E-08	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	8.55E-07	8.55E-07	mr1748	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	8.45E-07	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	2.60E-06	2.60E-06	mr1811	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	4.88E-07	mr1838	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	6.33E-06	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	7.73E-06	mr1856	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	1.51E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125082187	NA	6.91E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251