\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125066238:

Variant ID: vg0125066238 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25066238
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTTAACCTCACCCCCAGCACCGTACATACCATATCCACCTCCAGTAGTCAAAGCACACTTGCATCAACTCCTTTTCACTCCACTCACTTGCACTCAT[A/G]
GACTGACTCCAGCAATGGTTCTTGGAGCCTGGTTGATGAGTCCAGCCTCCGTGCCATGGAGCCTCCTGGCGTACGGTGTCCTGGGCCTGGTGCTCCTGTG

Reverse complement sequence

CACAGGAGCACCAGGCCCAGGACACCGTACGCCAGGAGGCTCCATGGCACGGAGGCTGGACTCATCAACCAGGCTCCAAGAACCATTGCTGGAGTCAGTC[T/C]
ATGAGTGCAAGTGAGTGGAGTGAAAAGGAGTTGATGCAAGTGTGCTTTGACTACTGGAGGTGGATATGGTATGTACGGTGCTGGGGGTGAGGTTAAATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.40% 0.25% 0.04% NA
All Indica  2759 37.80% 61.70% 0.40% 0.07% NA
All Japonica  1512 97.30% 2.60% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 51.80% 47.40% 0.50% 0.34% NA
Indica II  465 14.00% 85.80% 0.22% 0.00% NA
Indica III  913 46.10% 53.90% 0.00% 0.00% NA
Indica Intermediate  786 31.80% 67.30% 0.89% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125066238 A -> G LOC_Os01g43750.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:88.357; most accessible tissue: Callus, score: 99.299 N N N N
vg0125066238 A -> G LOC_Os01g43750.1 5_prime_UTR_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:88.357; most accessible tissue: Callus, score: 99.299 N N N N
vg0125066238 A -> G LOC_Os01g43760.1 upstream_gene_variant ; 4478.0bp to feature; MODIFIER silent_mutation Average:88.357; most accessible tissue: Callus, score: 99.299 N N N N
vg0125066238 A -> G LOC_Os01g43740.1 downstream_gene_variant ; 2629.0bp to feature; MODIFIER silent_mutation Average:88.357; most accessible tissue: Callus, score: 99.299 N N N N
vg0125066238 A -> DEL N N silent_mutation Average:88.357; most accessible tissue: Callus, score: 99.299 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0125066238 A G -0.07 -0.03 -0.01 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125066238 NA 7.25E-07 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 5.16E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 8.83E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 1.16E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 1.76E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 3.64E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 3.16E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 5.89E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 2.70E-06 mr1418 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 5.18E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 7.34E-06 7.34E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 5.37E-09 mr1715 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 9.14E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 8.12E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 2.26E-07 2.26E-07 mr1748 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 2.47E-06 mr1763 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 1.97E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 7.96E-06 7.96E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 4.01E-07 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 7.76E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 3.11E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 8.50E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 4.86E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125066238 NA 3.16E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251