Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125025708:

Variant ID: vg0125025708 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25025708
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, G: 0.24, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAAAAAGCTAAACTGTAGCAGGAAGGGTGTGAATTTATTTTTTCTGCCATGGTTAGCTGTGAAGGGGGCCAAACGCAAAACATTTGCCAACGTGGAGG[T/G]
GCAAGTCGATACGCTTTGATCAAATCAAGATAATGAATTTAAATGTGTATTTTGCATTCACAGATCTAAATGATAATATAATGTAACGTGTAATGTATTT

Reverse complement sequence

AAATACATTACACGTTACATTATATTATCATTTAGATCTGTGAATGCAAAATACACATTTAAATTCATTATCTTGATTTGATCAAAGCGTATCGACTTGC[A/C]
CCTCCACGTTGGCAAATGTTTTGCGTTTGGCCCCCTTCACAGCTAACCATGGCAGAAAAAATAAATTCACACCCTTCCTGCTACAGTTTAGCTTTTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	43.40%	0.11%	0.32%	NA
All Indica	2759	79.00%	20.40%	0.07%	0.51%	NA
All Japonica	1512	11.80%	88.10%	0.07%	0.00%	NA
Aus	269	86.20%	13.40%	0.00%	0.37%	NA
Indica I	595	70.10%	29.10%	0.34%	0.50%	NA
Indica II	465	96.80%	3.00%	0.00%	0.22%	NA
Indica III	913	68.20%	31.10%	0.00%	0.66%	NA
Indica Intermediate	786	87.80%	11.70%	0.00%	0.51%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	27.20%	72.60%	0.20%	0.00%	NA
Japonica Intermediate	241	13.70%	86.30%	0.00%	0.00%	NA
VI/Aromatic	96	19.80%	79.20%	1.04%	0.00%	NA
Intermediate	90	52.20%	46.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125025708	T -> G	LOC_Os01g43670.1	upstream_gene_variant ; 1079.0bp to feature; MODIFIER	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N
vg0125025708	T -> G	LOC_Os01g43660.1	downstream_gene_variant ; 804.0bp to feature; MODIFIER	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N
vg0125025708	T -> G	LOC_Os01g43680.1	downstream_gene_variant ; 4086.0bp to feature; MODIFIER	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N
vg0125025708	T -> G	LOC_Os01g43680.2	downstream_gene_variant ; 4086.0bp to feature; MODIFIER	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N
vg0125025708	T -> G	LOC_Os01g43680.3	downstream_gene_variant ; 4086.0bp to feature; MODIFIER	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N
vg0125025708	T -> G	LOC_Os01g43660-LOC_Os01g43670	intergenic_region ; MODIFIER	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N
vg0125025708	T -> DEL	N	N	silent_mutation	Average:58.413; most accessible tissue: Callus, score: 87.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125025708	NA	2.15E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	9.48E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	5.45E-07	1.62E-09	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	2.03E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.54E-16	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	3.90E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.54E-16	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	9.89E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	4.32E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.17E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	3.37E-10	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	2.29E-07	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	2.49E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	2.34E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	6.73E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	5.74E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	6.54E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	6.67E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.99E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.15E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.80E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	5.05E-11	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708	NA	1.43E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251