\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125025708:

Variant ID: vg0125025708 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25025708
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, G: 0.24, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAAAAGCTAAACTGTAGCAGGAAGGGTGTGAATTTATTTTTTCTGCCATGGTTAGCTGTGAAGGGGGCCAAACGCAAAACATTTGCCAACGTGGAGG[T/G]
GCAAGTCGATACGCTTTGATCAAATCAAGATAATGAATTTAAATGTGTATTTTGCATTCACAGATCTAAATGATAATATAATGTAACGTGTAATGTATTT

Reverse complement sequence

AAATACATTACACGTTACATTATATTATCATTTAGATCTGTGAATGCAAAATACACATTTAAATTCATTATCTTGATTTGATCAAAGCGTATCGACTTGC[A/C]
CCTCCACGTTGGCAAATGTTTTGCGTTTGGCCCCCTTCACAGCTAACCATGGCAGAAAAAATAAATTCACACCCTTCCTGCTACAGTTTAGCTTTTTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.40% 0.11% 0.32% NA
All Indica  2759 79.00% 20.40% 0.07% 0.51% NA
All Japonica  1512 11.80% 88.10% 0.07% 0.00% NA
Aus  269 86.20% 13.40% 0.00% 0.37% NA
Indica I  595 70.10% 29.10% 0.34% 0.50% NA
Indica II  465 96.80% 3.00% 0.00% 0.22% NA
Indica III  913 68.20% 31.10% 0.00% 0.66% NA
Indica Intermediate  786 87.80% 11.70% 0.00% 0.51% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 27.20% 72.60% 0.20% 0.00% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 79.20% 1.04% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125025708 T -> G LOC_Os01g43670.1 upstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N
vg0125025708 T -> G LOC_Os01g43660.1 downstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N
vg0125025708 T -> G LOC_Os01g43680.1 downstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N
vg0125025708 T -> G LOC_Os01g43680.2 downstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N
vg0125025708 T -> G LOC_Os01g43680.3 downstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N
vg0125025708 T -> G LOC_Os01g43660-LOC_Os01g43670 intergenic_region ; MODIFIER silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N
vg0125025708 T -> DEL N N silent_mutation Average:58.413; most accessible tissue: Callus, score: 87.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125025708 NA 2.15E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 9.48E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 5.45E-07 1.62E-09 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 2.03E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.54E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 3.90E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.54E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 9.89E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 4.32E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.17E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 3.37E-10 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 2.29E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 2.49E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 2.34E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 6.73E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 5.74E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 6.54E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 6.67E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.99E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.15E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.80E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 5.05E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125025708 NA 1.43E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251