\
| Variant ID: vg0124891937 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24891937 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAAACTTGGCAAGCTTTCTTATTTTTGACCTAAAAGTTGCTACTCTATGTCCCATAATATAGCAATTTAGGATCGGATGGAACATTTTAGGTAGTGTTT[A/G]
GTTGCAATAATGAGATGGGATAGGACGAACCCACTTTTAAGGGTGTTTGGTTGAGGGGTGAGTAAGATGGGTTGGTCCCTAGAGAGGAATATTCCTCTCA
TGAGAGGAATATTCCTCTCTAGGGACCAACCCATCTTACTCACCCCTCAACCAAACACCCTTAAAAGTGGGTTCGTCCTATCCCATCTCATTATTGCAAC[T/C]
AAACACTACCTAAAATGTTCCATCCGATCCTAAATTGCTATATTATGGGACATAGAGTAGCAACTTTTAGGTCAAAAATAAGAAAGCTTGCCAAGTTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 15.50% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 53.00% | 46.40% | 0.53% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 18.00% | 81.20% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 29.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124891937 | A -> G | LOC_Os01g43470.1 | upstream_gene_variant ; 238.0bp to feature; MODIFIER | silent_mutation | Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0124891937 | A -> G | LOC_Os01g43480.1 | upstream_gene_variant ; 2601.0bp to feature; MODIFIER | silent_mutation | Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0124891937 | A -> G | LOC_Os01g43480.2 | upstream_gene_variant ; 3312.0bp to feature; MODIFIER | silent_mutation | Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0124891937 | A -> G | LOC_Os01g43480.3 | upstream_gene_variant ; 4180.0bp to feature; MODIFIER | silent_mutation | Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0124891937 | A -> G | LOC_Os01g43460-LOC_Os01g43470 | intergenic_region ; MODIFIER | silent_mutation | Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124891937 | NA | 7.68E-14 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124891937 | NA | 1.30E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124891937 | 1.41E-06 | 6.63E-06 | mr1543 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124891937 | NA | 2.00E-09 | mr1543 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124891937 | NA | 2.72E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124891937 | NA | 1.77E-15 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124891937 | NA | 1.18E-15 | mr1031_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |