Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124891937:

Variant ID: vg0124891937 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24891937
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAACTTGGCAAGCTTTCTTATTTTTGACCTAAAAGTTGCTACTCTATGTCCCATAATATAGCAATTTAGGATCGGATGGAACATTTTAGGTAGTGTTT[A/G]
GTTGCAATAATGAGATGGGATAGGACGAACCCACTTTTAAGGGTGTTTGGTTGAGGGGTGAGTAAGATGGGTTGGTCCCTAGAGAGGAATATTCCTCTCA

Reverse complement sequence

TGAGAGGAATATTCCTCTCTAGGGACCAACCCATCTTACTCACCCCTCAACCAAACACCCTTAAAAGTGGGTTCGTCCTATCCCATCTCATTATTGCAAC[T/C]
AAACACTACCTAAAATGTTCCATCCGATCCTAAATTGCTATATTATGGGACATAGAGTAGCAACTTTTAGGTCAAAAATAAGAAAGCTTGCCAAGTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	15.50%	0.21%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.07%	0.00%	NA
All Japonica	1512	53.00%	46.40%	0.53%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	18.00%	81.20%	0.78%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	70.10%	29.00%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124891937	A -> G	LOC_Os01g43470.1	upstream_gene_variant ; 238.0bp to feature; MODIFIER	silent_mutation	Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0124891937	A -> G	LOC_Os01g43480.1	upstream_gene_variant ; 2601.0bp to feature; MODIFIER	silent_mutation	Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0124891937	A -> G	LOC_Os01g43480.2	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0124891937	A -> G	LOC_Os01g43480.3	upstream_gene_variant ; 4180.0bp to feature; MODIFIER	silent_mutation	Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0124891937	A -> G	LOC_Os01g43460-LOC_Os01g43470	intergenic_region ; MODIFIER	silent_mutation	Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124891937	NA	7.68E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937	NA	1.30E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937	1.41E-06	6.63E-06	mr1543	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937	NA	2.00E-09	mr1543	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937	NA	2.72E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937	NA	1.77E-15	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937	NA	1.18E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251