\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124891937:

Variant ID: vg0124891937 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24891937
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAACTTGGCAAGCTTTCTTATTTTTGACCTAAAAGTTGCTACTCTATGTCCCATAATATAGCAATTTAGGATCGGATGGAACATTTTAGGTAGTGTTT[A/G]
GTTGCAATAATGAGATGGGATAGGACGAACCCACTTTTAAGGGTGTTTGGTTGAGGGGTGAGTAAGATGGGTTGGTCCCTAGAGAGGAATATTCCTCTCA

Reverse complement sequence

TGAGAGGAATATTCCTCTCTAGGGACCAACCCATCTTACTCACCCCTCAACCAAACACCCTTAAAAGTGGGTTCGTCCTATCCCATCTCATTATTGCAAC[T/C]
AAACACTACCTAAAATGTTCCATCCGATCCTAAATTGCTATATTATGGGACATAGAGTAGCAACTTTTAGGTCAAAAATAAGAAAGCTTGCCAAGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.50% 0.21% 0.00% NA
All Indica  2759 99.60% 0.40% 0.07% 0.00% NA
All Japonica  1512 53.00% 46.40% 0.53% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 18.00% 81.20% 0.78% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.00% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124891937 A -> G LOC_Os01g43470.1 upstream_gene_variant ; 238.0bp to feature; MODIFIER silent_mutation Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0124891937 A -> G LOC_Os01g43480.1 upstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0124891937 A -> G LOC_Os01g43480.2 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0124891937 A -> G LOC_Os01g43480.3 upstream_gene_variant ; 4180.0bp to feature; MODIFIER silent_mutation Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0124891937 A -> G LOC_Os01g43460-LOC_Os01g43470 intergenic_region ; MODIFIER silent_mutation Average:59.569; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124891937 NA 7.68E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937 NA 1.30E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937 1.41E-06 6.63E-06 mr1543 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937 NA 2.00E-09 mr1543 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937 NA 2.72E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937 NA 1.77E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124891937 NA 1.18E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251