\
| Variant ID: vg0124879589 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24879589 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, A: 0.33, others allele: 0.00, population size: 80. )
ATACAATTTATATTAATTTATATTGTAGTTATAGTATACTTGTGGTGGAATTATATTACAACTATGTTACATTTAAAAGTTTGTCATTCAAAAAAAATTG[C/A]
GGCAATTTTTTTATAGTCCCTTTAAATAAAAAACACTAGAAACTTCGGTATGATTGCGGATTGAAAGATATGTCGCCAAGTATTCAAGTCAATGTGTACC
GGTACACATTGACTTGAATACTTGGCGACATATCTTTCAATCCGCAATCATACCGAAGTTTCTAGTGTTTTTTATTTAAAGGGACTATAAAAAAATTGCC[G/T]
CAATTTTTTTTGAATGACAAACTTTTAAATGTAACATAGTTGTAATATAATTCCACCACAAGTATACTATAACTACAATATAAATTAATATAAATTGTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 48.80% | 1.12% | 0.00% | NA |
| All Indica | 2759 | 62.50% | 35.70% | 1.85% | 0.00% | NA |
| All Japonica | 1512 | 22.00% | 77.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 48.90% | 50.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 48.60% | 44.70% | 6.67% | 0.00% | NA |
| Indica III | 913 | 72.40% | 27.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 69.50% | 28.80% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 84.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124879589 | C -> A | LOC_Os01g43460-LOC_Os01g43470 | intergenic_region ; MODIFIER | silent_mutation | Average:46.822; most accessible tissue: Callus, score: 70.297 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124879589 | NA | 1.03E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 9.42E-07 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 3.63E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 2.93E-10 | mr1633 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 1.20E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 9.84E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 1.98E-07 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 5.50E-09 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 1.70E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 1.49E-08 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 6.74E-08 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 2.13E-06 | mr1545_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 1.49E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124879589 | NA | 1.19E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |