Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124877300:

Variant ID: vg0124877300 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24877300
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAATTTAAATATTTTCTATATATAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTATAGATCCAAAGTTTATAAGTCAAAAGTTTACATAC[T/C]
GGATTCAAATTTGAATTTGAATTATATCTGATTCAAATTTGAATTTGAATTCAAATATTATCTATATATAGTATTTCAATACATCTAAAGTTTATACACC

Reverse complement sequence

GGTGTATAAACTTTAGATGTATTGAAATACTATATATAGATAATATTTGAATTCAAATTCAAATTTGAATCAGATATAATTCAAATTCAAATTTGAATCC[A/G]
GTATGTAAACTTTTGACTTATAAACTTTGGATCTATAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTATATATAGAAAATATTTAAATTCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	13.40%	3.36%	2.31%	NA
All Indica	2759	92.40%	0.30%	3.77%	3.59%	NA
All Japonica	1512	57.20%	39.00%	3.17%	0.66%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	91.90%	0.20%	4.87%	3.03%	NA
Indica II	465	88.60%	0.60%	5.16%	5.59%	NA
Indica III	913	96.60%	0.10%	1.42%	1.86%	NA
Indica Intermediate	786	89.90%	0.40%	4.83%	4.83%	NA
Temperate Japonica	767	36.00%	57.10%	5.74%	1.17%	NA
Tropical Japonica	504	86.90%	12.70%	0.20%	0.20%	NA
Japonica Intermediate	241	62.70%	36.10%	1.24%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	73.30%	18.90%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124877300	T -> DEL	N	N	silent_mutation	Average:20.204; most accessible tissue: Zhenshan97 flag leaf, score: 28.494	N	N	N	N
vg0124877300	T -> C	LOC_Os01g43460-LOC_Os01g43470	intergenic_region ; MODIFIER	silent_mutation	Average:20.204; most accessible tissue: Zhenshan97 flag leaf, score: 28.494	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124877300	5.51E-06	NA	mr1534	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251