\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124877078:

Variant ID: vg0124877078 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24877078
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAGTTTACACATCTAAAGTTTAGAGACCAAAAGTTTATAAGTCAAAAGTTTATATATCCGATTCAAATTTGAATTTGAATTCAAATATTTTTTTATAT[G/A]
TAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTATAGACCTAAATTTTATAGACCTAAAGTTTATATACTTGTTTCAAATTTGAATTTGAATT

Reverse complement sequence

AATTCAAATTCAAATTTGAAACAAGTATATAAACTTTAGGTCTATAAAATTTAGGTCTATAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTA[C/T]
ATATAAAAAAATATTTGAATTCAAATTCAAATTTGAATCGGATATATAAACTTTTGACTTATAAACTTTTGGTCTCTAAACTTTAGATGTGTAAACTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 26.10% 3.26% 0.59% NA
All Indica  2759 94.10% 0.40% 4.57% 0.94% NA
All Japonica  1512 21.00% 77.30% 1.65% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 93.80% 0.30% 5.21% 0.67% NA
Indica II  465 91.60% 0.60% 6.45% 1.29% NA
Indica III  913 97.40% 0.20% 1.97% 0.44% NA
Indica Intermediate  786 91.90% 0.60% 5.98% 1.53% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 51.60% 43.30% 4.96% 0.20% NA
Japonica Intermediate  241 18.70% 81.30% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 26.00% 1.04% 0.00% NA
Intermediate  90 67.80% 28.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124877078 G -> A LOC_Os01g43460-LOC_Os01g43470 intergenic_region ; MODIFIER silent_mutation Average:47.096; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0124877078 G -> DEL N N silent_mutation Average:47.096; most accessible tissue: Minghui63 root, score: 73.73 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124877078 NA 6.81E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 5.70E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 1.07E-09 mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 2.28E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 5.81E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 9.53E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 4.85E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 1.70E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 1.75E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124877078 NA 7.44E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251