Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124723474:

Variant ID: vg0124723474 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24723474
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAGCATAATATAAACGGAATGGAAGTACTAATATAAACCTATTCATATTCTGGTATTATGGAGGGACATGATTTTATACATAATACTCCCTCCGTTTCA[T/C]
AATGTAAGTCATTCTAGCATTTCCTACATTCATATTGATATTAATGAATCTAGATAGATATATATGTCTAGATTCATTAACATCAATATGAATGTGGGAA

Reverse complement sequence

TTCCCACATTCATATTGATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAATATCAATATGAATGTAGGAAATGCTAGAATGACTTACATT[A/G]
TGAAACGGAGGGAGTATTATGTATAAAATCATGTCCCTCCATAATACCAGAATATGAATAGGTTTATATTAGTACTTCCATTCCGTTTATATTATGCTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	45.60%	2.77%	3.89%	NA
All Indica	2759	42.30%	53.80%	1.99%	1.88%	NA
All Japonica	1512	64.90%	22.00%	4.76%	8.33%	NA
Aus	269	1.90%	98.10%	0.00%	0.00%	NA
Indica I	595	57.10%	37.30%	2.86%	2.69%	NA
Indica II	465	48.60%	48.00%	1.72%	1.72%	NA
Indica III	913	36.70%	59.80%	1.86%	1.64%	NA
Indica Intermediate	786	33.80%	62.80%	1.65%	1.65%	NA
Temperate Japonica	767	83.80%	1.00%	6.91%	8.21%	NA
Tropical Japonica	504	32.30%	55.60%	1.59%	10.52%	NA
Japonica Intermediate	241	72.60%	18.70%	4.56%	4.15%	NA
VI/Aromatic	96	58.30%	37.50%	1.04%	3.12%	NA
Intermediate	90	52.20%	41.10%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124723474	T -> DEL	N	N	silent_mutation	Average:24.368; most accessible tissue: Callus, score: 51.816	N	N	N	N
vg0124723474	T -> C	LOC_Os01g43274-LOC_Os01g43280	intergenic_region ; MODIFIER	silent_mutation	Average:24.368; most accessible tissue: Callus, score: 51.816	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124723474	NA	3.55E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	2.61E-06	NA	mr1388	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	NA	3.35E-07	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	3.49E-07	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	NA	3.80E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	1.48E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	NA	1.52E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	1.84E-08	1.58E-24	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	NA	2.19E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	1.99E-07	NA	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	NA	4.95E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	8.69E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	1.13E-06	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124723474	1.59E-08	4.63E-20	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251