\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124700675:

Variant ID: vg0124700675 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24700675
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCACAGTAGTCCAGTCCATTTTTTATAGATATATTTTTAAGACTCGGTAGTTACTAGTTACTCCATCCATTTCATAATATAAATCATTCTAGCATCG[T/C]
CCACATTAACATCTATATGAATGTGGGCAATACTAGAATGACTTACATGTCTAAATTCATTAACATCTATATGAATATATACAATGCTAGAATAACTTAC

Reverse complement sequence

GTAAGTTATTCTAGCATTGTATATATTCATATAGATGTTAATGAATTTAGACATGTAAGTCATTCTAGTATTGCCCACATTCATATAGATGTTAATGTGG[A/G]
CGATGCTAGAATGATTTATATTATGAAATGGATGGAGTAACTAGTAACTACCGAGTCTTAAAAATATATCTATAAAAAATGGACTGGACTACTGTGAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.50% 0.25% 0.00% NA
All Indica  2759 98.90% 0.70% 0.43% 0.00% NA
All Japonica  1512 39.40% 60.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.50% 2.20% 1.34% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.40% 0.38% 0.00% NA
Temperate Japonica  767 19.60% 80.40% 0.00% 0.00% NA
Tropical Japonica  504 74.80% 25.20% 0.00% 0.00% NA
Japonica Intermediate  241 28.60% 71.40% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124700675 T -> C LOC_Os01g43230.1 upstream_gene_variant ; 2762.0bp to feature; MODIFIER silent_mutation Average:70.022; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg0124700675 T -> C LOC_Os01g43230.2 upstream_gene_variant ; 2762.0bp to feature; MODIFIER silent_mutation Average:70.022; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg0124700675 T -> C LOC_Os01g43230.3 upstream_gene_variant ; 2762.0bp to feature; MODIFIER silent_mutation Average:70.022; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg0124700675 T -> C LOC_Os01g43220.1 downstream_gene_variant ; 3604.0bp to feature; MODIFIER silent_mutation Average:70.022; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg0124700675 T -> C LOC_Os01g43250.1 downstream_gene_variant ; 3096.0bp to feature; MODIFIER silent_mutation Average:70.022; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg0124700675 T -> C LOC_Os01g43230-LOC_Os01g43250 intergenic_region ; MODIFIER silent_mutation Average:70.022; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124700675 T C -0.03 -0.05 -0.02 -0.03 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124700675 NA 9.69E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 6.37E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 9.87E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 6.21E-06 NA mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 1.00E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 2.45E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 9.84E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 1.16E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 8.19E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 2.13E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 3.33E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 2.36E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 1.25E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 6.16E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 5.14E-06 mr1757_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 2.48E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 4.35E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 6.67E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124700675 NA 2.96E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251