Variant ID: vg0124676757 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 24676757 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 336. )
GGTGTGGTGAAACCATGTGTCTTTTAGGGACTTAAGCACATCTGTTAAAGCAGTGTGCGCATGGCGTATGCCCAATACTTTCGAAATTTCTTTATTCACA[G/A]
CATTCAAGCTTTTTTATAGCTGTTTTGCTATGTGAATTTTCAATGATGTAGTCAACTTTAGGTTGCTCGTATCAATTTTTACAAAGCAGTCGGTATATCA
TGATATACCGACTGCTTTGTAAAAATTGATACGAGCAACCTAAAGTTGACTACATCATTGAAAATTCACATAGCAAAACAGCTATAAAAAAGCTTGAATG[C/T]
TGTGAATAAAGAAATTTCGAAAGTATTGGGCATACGCCATGCGCACACTGCTTTAACAGATGTGCTTAAGTCCCTAAAAGACACATGGTTTCACCACACC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.00% | 4.00% | 0.04% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.00% | 10.80% | 0.13% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 70.60% | 29.20% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 93.80% | 5.80% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0124676757 | G -> A | LOC_Os01g43210.1 | upstream_gene_variant ; 2833.0bp to feature; MODIFIER | silent_mutation | Average:24.25; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
vg0124676757 | G -> A | LOC_Os01g43200.1 | downstream_gene_variant ; 4531.0bp to feature; MODIFIER | silent_mutation | Average:24.25; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
vg0124676757 | G -> A | LOC_Os01g43200-LOC_Os01g43210 | intergenic_region ; MODIFIER | silent_mutation | Average:24.25; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0124676757 | 6.03E-07 | 2.42E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | NA | 1.09E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 1.32E-06 | 8.02E-08 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 3.48E-06 | NA | mr1104 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 1.05E-09 | 4.22E-09 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 4.76E-08 | 1.55E-08 | mr1227 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 1.14E-06 | NA | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 3.68E-06 | 6.09E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 2.06E-08 | 2.06E-08 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124676757 | 6.15E-08 | 3.19E-10 | mr1082_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/