RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0124676757:

Variant ID: vg0124676757 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24676757
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGTGGTGAAACCATGTGTCTTTTAGGGACTTAAGCACATCTGTTAAAGCAGTGTGCGCATGGCGTATGCCCAATACTTTCGAAATTTCTTTATTCACA[G/A]
CATTCAAGCTTTTTTATAGCTGTTTTGCTATGTGAATTTTCAATGATGTAGTCAACTTTAGGTTGCTCGTATCAATTTTTACAAAGCAGTCGGTATATCA

Reverse complement sequence

TGATATACCGACTGCTTTGTAAAAATTGATACGAGCAACCTAAAGTTGACTACATCATTGAAAATTCACATAGCAAAACAGCTATAAAAAAGCTTGAATG[C/T]
TGTGAATAAAGAAATTTCGAAAGTATTGGGCATACGCCATGCGCACACTGCTTTAACAGATGTGCTTAAGTCCCTAAAAGACACATGGTTTCACCACACC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	4.00%	0.04%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	89.00%	10.80%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	70.60%	29.20%	0.20%	0.00%	NA
Japonica Intermediate	241	93.80%	5.80%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124676757	G -> A	LOC_Os01g43210.1	upstream_gene_variant ; 2833.0bp to feature; MODIFIER	silent_mutation	Average:24.25; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0124676757	G -> A	LOC_Os01g43200.1	downstream_gene_variant ; 4531.0bp to feature; MODIFIER	silent_mutation	Average:24.25; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0124676757	G -> A	LOC_Os01g43200-LOC_Os01g43210	intergenic_region ; MODIFIER	silent_mutation	Average:24.25; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124676757	6.03E-07	2.42E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	NA	1.09E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	1.32E-06	8.02E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	3.48E-06	NA	mr1104	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	1.05E-09	4.22E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	4.76E-08	1.55E-08	mr1227	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	1.14E-06	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	3.68E-06	6.09E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	2.06E-08	2.06E-08	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676757	6.15E-08	3.19E-10	mr1082_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 17 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0124676757:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact