Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124676100:

Variant ID: vg0124676100 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24676100
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CTATGCTCGAAGACTGGACCAATCATTATTCCCCGTAATGGCTATCAACCGAATACTTGCACCAGTCGGGATTCAATTTTTATATCTATTTTGGAGTATC[C/T]
CATAAGGGATAATCACTCAGATCAGAAGCTATTCATATGAGCTACACTTGGTCTATATCACCCGGAAGATTTATTACACGGGAGCATGTTACATGTGTCA

Reverse complement sequence

TGACACATGTAACATGCTCCCGTGTAATAAATCTTCCGGGTGATATAGACCAAGTGTAGCTCATATGAATAGCTTCTGATCTGAGTGATTATCCCTTATG[G/A]
GATACTCCAAAATAGATATAAAAATTGAATCCCGACTGGTGCAAGTATTCGGTTGATAGCCATTACGGGGAATAATGATTGGTCCAGTCTTCGAGCATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 4.20% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 88.40% 11.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 69.60% 30.40% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124676100 C -> T LOC_Os01g43210.1 upstream_gene_variant ; 3490.0bp to feature; MODIFIER silent_mutation Average:15.723; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg0124676100 C -> T LOC_Os01g43200.1 downstream_gene_variant ; 3874.0bp to feature; MODIFIER silent_mutation Average:15.723; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg0124676100 C -> T LOC_Os01g43200-LOC_Os01g43210 intergenic_region ; MODIFIER silent_mutation Average:15.723; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124676100 1.31E-07 1.57E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 4.22E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 3.05E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 7.44E-06 3.12E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 7.43E-06 7.43E-06 mr1436 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 5.11E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 4.81E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 1.21E-09 1.21E-09 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 1.11E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 9.54E-06 4.85E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 1.95E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 5.15E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 7.59E-06 7.59E-06 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 3.57E-06 7.36E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 NA 2.39E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124676100 8.65E-06 NA mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251