\
| Variant ID: vg0124673365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24673365 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTGCCTTCGCCACCGCCGACTGGTGTCTCCGCCTGCACGATTGGCCTATTATGCCGCCGTTGTTGGGCATCTACGTCTTCACCGCCGGCTTGCCTTCGC[C/T]
GCCGGCGACTGGTGTCTCCGCCTGCACGGCTGGCCTATTATGCCGCCGTTTGTTGGGCGTCTACGTCTTCACCGACCGGCTTGCCTTCGCCGCTGCCGAC
GTCGGCAGCGGCGAAGGCAAGCCGGTCGGTGAAGACGTAGACGCCCAACAAACGGCGGCATAATAGGCCAGCCGTGCAGGCGGAGACACCAGTCGCCGGC[G/A]
GCGAAGGCAAGCCGGCGGTGAAGACGTAGATGCCCAACAACGGCGGCATAATAGGCCAATCGTGCAGGCGGAGACACCAGTCGGCGGTGGCGAAGGCAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.20% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 13.70% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 95.60% | 3.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 76.80% | 22.60% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 82.60% | 16.00% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124673365 | C -> T | LOC_Os01g43200.1 | downstream_gene_variant ; 1139.0bp to feature; MODIFIER | silent_mutation | Average:52.351; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0124673365 | C -> T | LOC_Os01g43200-LOC_Os01g43210 | intergenic_region ; MODIFIER | silent_mutation | Average:52.351; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124673365 | NA | 3.25E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124673365 | 7.58E-07 | 7.62E-07 | mr1423 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124673365 | 6.80E-06 | 8.22E-06 | mr1438 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124673365 | NA | 2.32E-06 | mr1755 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |