\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124666730:

Variant ID: vg0124666730 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24666730
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATCTCCGCAGGAATATAGCTGGAGAGGAGGTTGTGAGCCAGGAGCGCCGCGAGCTTCTGCAGCGTCGTGATGGCGACCGGGATCTGGCCGGCAAGCT[G/A]
GTTGTAGGGTAGCGACAACTCGGATGGGAGGTAGCTCGTGAGTGAGAAGTTGGCGAGCTCCACGTCGCCGACCCTGCCACCGCCGCCGTCGTCGACGCAG

Reverse complement sequence

CTGCGTCGACGACGGCGGCGGTGGCAGGGTCGGCGACGTGGAGCTCGCCAACTTCTCACTCACGAGCTACCTCCCATCCGAGTTGTCGCTACCCTACAAC[C/T]
AGCTTGCCGGCCAGATCCCGGTCGCCATCACGACGCTGCAGAAGCTCGCGGCGCTCCTGGCTCACAACCTCCTCTCCAGCTATATTCCTGCGGAGATTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.30% 0.02% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 83.20% 16.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 56.00% 44.00% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124666730 G -> A LOC_Os01g43180-LOC_Os01g43200 intergenic_region ; MODIFIER silent_mutation Average:71.065; most accessible tissue: Zhenshan97 young leaf, score: 88.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124666730 3.82E-07 1.96E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 1.01E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 1.96E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 4.09E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 1.18E-06 1.32E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 7.17E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 2.71E-06 2.71E-06 mr1436 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 3.77E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 2.43E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 2.57E-06 mr1126_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 2.68E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124666730 NA 2.79E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251