\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124654977:

Variant ID: vg0124654977 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24654977
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCCGGCCCAATGGCTGGTGGGCCTCTGTCACACTGCACCATATAAAAGGGATGGAGGCCGGGGCGGCTCACGATACGAGGTTCGTTGCCGCCGCCACT[T/C]
CACCCCACAAACCCTAACCGATCAAAAGGGGGCGTAGCCAGTGACGGGAAGACGCCACCGCCGCGCCACGTCTTATCGTCGGGATCGCCTACGACCACCA

Reverse complement sequence

TGGTGGTCGTAGGCGATCCCGACGATAAGACGTGGCGCGGCGGTGGCGTCTTCCCGTCACTGGCTACGCCCCCTTTTGATCGGTTAGGGTTTGTGGGGTG[A/G]
AGTGGCGGCGGCAACGAACCTCGTATCGTGAGCCGCCCCGGCCTCCATCCCTTTTATATGGTGCAGTGTGACAGAGGCCCACCAGCCATTGGGCCGGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.70% 21.60% 1.76% 50.91% NA
All Indica  2759 12.60% 0.70% 2.61% 84.16% NA
All Japonica  1512 36.60% 60.90% 0.07% 2.38% NA
Aus  269 94.10% 0.70% 0.37% 4.83% NA
Indica I  595 6.90% 0.70% 6.05% 86.39% NA
Indica II  465 11.80% 0.60% 1.94% 85.59% NA
Indica III  913 14.30% 0.40% 0.88% 84.34% NA
Indica Intermediate  786 15.30% 0.90% 2.42% 81.42% NA
Temperate Japonica  767 18.90% 80.60% 0.00% 0.52% NA
Tropical Japonica  504 69.80% 25.20% 0.00% 4.96% NA
Japonica Intermediate  241 23.70% 73.00% 0.41% 2.90% NA
VI/Aromatic  96 37.50% 60.40% 1.04% 1.04% NA
Intermediate  90 28.90% 24.40% 8.89% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124654977 T -> DEL N N silent_mutation Average:73.176; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg0124654977 T -> C LOC_Os01g43180-LOC_Os01g43200 intergenic_region ; MODIFIER silent_mutation Average:73.176; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124654977 T C -0.01 0.02 0.03 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124654977 NA 5.97E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 3.96E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 3.53E-06 NA mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 6.31E-07 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 4.93E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 3.15E-07 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 2.37E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 1.77E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 2.60E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 7.44E-08 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 4.15E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 1.09E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 2.66E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124654977 NA 3.45E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251