\
| Variant ID: vg0124506200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24506200 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
TTCAAGTGTCGAATCTCTACTAGTGAAAATTGAGTCCTAGAATACTACCAGGATGAGCCACATCATTTGATTAATATCAACCGTTAGGTTCATGAAGTGA[T/C]
AAAATAGATAGAATAAATCTCAGCCATTGAATGAAAGAGGGTATACTAGAATTTTCTGGTACTCCCTCAACGTGGCAAAGAGATAAGAATAGTAGACATT
AATGTCTACTATTCTTATCTCTTTGCCACGTTGAGGGAGTACCAGAAAATTCTAGTATACCCTCTTTCATTCAATGGCTGAGATTTATTCTATCTATTTT[A/G]
TCACTTCATGAACCTAACGGTTGATATTAATCAAATGATGTGGCTCATCCTGGTAGTATTCTAGGACTCAATTTTCACTAGTAGAGATTCGACACTTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 25.20% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 28.80% | 71.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.40% | 87.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 22.00% | 78.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124506200 | T -> C | LOC_Os01g43020.1 | upstream_gene_variant ; 1344.0bp to feature; MODIFIER | silent_mutation | Average:58.262; most accessible tissue: Callus, score: 85.209 | N | N | N | N |
| vg0124506200 | T -> C | LOC_Os01g43020-LOC_Os01g43030 | intergenic_region ; MODIFIER | silent_mutation | Average:58.262; most accessible tissue: Callus, score: 85.209 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124506200 | NA | 7.02E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 1.22E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 2.36E-13 | mr1537_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 4.48E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 4.75E-14 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 2.46E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 6.47E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 4.83E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 1.22E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 8.52E-16 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124506200 | NA | 7.89E-16 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |