\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124506200:

Variant ID: vg0124506200 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24506200
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAGTGTCGAATCTCTACTAGTGAAAATTGAGTCCTAGAATACTACCAGGATGAGCCACATCATTTGATTAATATCAACCGTTAGGTTCATGAAGTGA[T/C]
AAAATAGATAGAATAAATCTCAGCCATTGAATGAAAGAGGGTATACTAGAATTTTCTGGTACTCCCTCAACGTGGCAAAGAGATAAGAATAGTAGACATT

Reverse complement sequence

AATGTCTACTATTCTTATCTCTTTGCCACGTTGAGGGAGTACCAGAAAATTCTAGTATACCCTCTTTCATTCAATGGCTGAGATTTATTCTATCTATTTT[A/G]
TCACTTCATGAACCTAACGGTTGATATTAATCAAATGATGTGGCTCATCCTGGTAGTATTCTAGGACTCAATTTTCACTAGTAGAGATTCGACACTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 25.20% 0.08% 0.00% NA
All Indica  2759 99.70% 0.30% 0.07% 0.00% NA
All Japonica  1512 28.80% 71.10% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 12.40% 87.40% 0.26% 0.00% NA
Tropical Japonica  504 56.90% 43.10% 0.00% 0.00% NA
Japonica Intermediate  241 22.00% 78.00% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124506200 T -> C LOC_Os01g43020.1 upstream_gene_variant ; 1344.0bp to feature; MODIFIER silent_mutation Average:58.262; most accessible tissue: Callus, score: 85.209 N N N N
vg0124506200 T -> C LOC_Os01g43020-LOC_Os01g43030 intergenic_region ; MODIFIER silent_mutation Average:58.262; most accessible tissue: Callus, score: 85.209 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124506200 NA 7.02E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 1.22E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 2.36E-13 mr1537_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 4.48E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 4.75E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 2.46E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 6.47E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 4.83E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 1.22E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 8.52E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124506200 NA 7.89E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251